ID: 1034087320

View in Genome Browser
Species Human (GRCh38)
Location 7:148331889-148331911
Sequence AAGTTGTGTGAGAGGGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034087313_1034087320 20 Left 1034087313 7:148331846-148331868 CCAACAACTACTACACACTGCCC 0: 1
1: 0
2: 2
3: 10
4: 132
Right 1034087320 7:148331889-148331911 AAGTTGTGTGAGAGGGCAGGAGG No data
1034087315_1034087320 0 Left 1034087315 7:148331866-148331888 CCCTGCACATGATCACGTTCGGT 0: 1
1: 0
2: 0
3: 0
4: 29
Right 1034087320 7:148331889-148331911 AAGTTGTGTGAGAGGGCAGGAGG No data
1034087316_1034087320 -1 Left 1034087316 7:148331867-148331889 CCTGCACATGATCACGTTCGGTA 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1034087320 7:148331889-148331911 AAGTTGTGTGAGAGGGCAGGAGG No data
1034087311_1034087320 22 Left 1034087311 7:148331844-148331866 CCCCAACAACTACTACACACTGC 0: 1
1: 0
2: 0
3: 7
4: 132
Right 1034087320 7:148331889-148331911 AAGTTGTGTGAGAGGGCAGGAGG No data
1034087312_1034087320 21 Left 1034087312 7:148331845-148331867 CCCAACAACTACTACACACTGCC 0: 1
1: 1
2: 0
3: 13
4: 94
Right 1034087320 7:148331889-148331911 AAGTTGTGTGAGAGGGCAGGAGG No data
1034087310_1034087320 23 Left 1034087310 7:148331843-148331865 CCCCCAACAACTACTACACACTG 0: 1
1: 0
2: 0
3: 8
4: 160
Right 1034087320 7:148331889-148331911 AAGTTGTGTGAGAGGGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034087320 Original CRISPR AAGTTGTGTGAGAGGGCAGG AGG Intronic
No off target data available for this crispr