ID: 1034089726

View in Genome Browser
Species Human (GRCh38)
Location 7:148352651-148352673
Sequence GTTGAATCCATGAGCTCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 149}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034089726_1034089738 21 Left 1034089726 7:148352651-148352673 CCCTCTGAGCTCATGGATTCAAC 0: 1
1: 0
2: 1
3: 10
4: 149
Right 1034089738 7:148352695-148352717 ACTGATGGTAGGAGTATGGGGGG No data
1034089726_1034089735 18 Left 1034089726 7:148352651-148352673 CCCTCTGAGCTCATGGATTCAAC 0: 1
1: 0
2: 1
3: 10
4: 149
Right 1034089735 7:148352692-148352714 GAAACTGATGGTAGGAGTATGGG 0: 1
1: 0
2: 1
3: 16
4: 165
1034089726_1034089729 -6 Left 1034089726 7:148352651-148352673 CCCTCTGAGCTCATGGATTCAAC 0: 1
1: 0
2: 1
3: 10
4: 149
Right 1034089729 7:148352668-148352690 TTCAACCCTTGTGCTGCAGGTGG 0: 1
1: 0
2: 0
3: 9
4: 134
1034089726_1034089733 10 Left 1034089726 7:148352651-148352673 CCCTCTGAGCTCATGGATTCAAC 0: 1
1: 0
2: 1
3: 10
4: 149
Right 1034089733 7:148352684-148352706 CAGGTGGAGAAACTGATGGTAGG 0: 1
1: 0
2: 9
3: 74
4: 631
1034089726_1034089739 27 Left 1034089726 7:148352651-148352673 CCCTCTGAGCTCATGGATTCAAC 0: 1
1: 0
2: 1
3: 10
4: 149
Right 1034089739 7:148352701-148352723 GGTAGGAGTATGGGGGGCTGTGG 0: 1
1: 0
2: 3
3: 47
4: 560
1034089726_1034089737 20 Left 1034089726 7:148352651-148352673 CCCTCTGAGCTCATGGATTCAAC 0: 1
1: 0
2: 1
3: 10
4: 149
Right 1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG 0: 1
1: 0
2: 1
3: 7
4: 134
1034089726_1034089732 6 Left 1034089726 7:148352651-148352673 CCCTCTGAGCTCATGGATTCAAC 0: 1
1: 0
2: 1
3: 10
4: 149
Right 1034089732 7:148352680-148352702 GCTGCAGGTGGAGAAACTGATGG 0: 1
1: 0
2: 2
3: 40
4: 465
1034089726_1034089734 17 Left 1034089726 7:148352651-148352673 CCCTCTGAGCTCATGGATTCAAC 0: 1
1: 0
2: 1
3: 10
4: 149
Right 1034089734 7:148352691-148352713 AGAAACTGATGGTAGGAGTATGG No data
1034089726_1034089736 19 Left 1034089726 7:148352651-148352673 CCCTCTGAGCTCATGGATTCAAC 0: 1
1: 0
2: 1
3: 10
4: 149
Right 1034089736 7:148352693-148352715 AAACTGATGGTAGGAGTATGGGG No data
1034089726_1034089728 -9 Left 1034089726 7:148352651-148352673 CCCTCTGAGCTCATGGATTCAAC 0: 1
1: 0
2: 1
3: 10
4: 149
Right 1034089728 7:148352665-148352687 GGATTCAACCCTTGTGCTGCAGG 0: 1
1: 0
2: 0
3: 5
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034089726 Original CRISPR GTTGAATCCATGAGCTCAGA GGG (reversed) Intronic
902791648 1:18772838-18772860 GTTGAACTAATGAGCACAGATGG + Intergenic
905616060 1:39399921-39399943 TTTGAATCCTAGAGCTCACATGG - Intronic
910441354 1:87255710-87255732 GATGAAGCCAAGAGCTCAGGGGG + Intergenic
910480815 1:87656347-87656369 GTTGAATCCATGAGAGTGGAGGG + Intergenic
914374856 1:147063997-147064019 GTTGAACCCAATACCTCAGATGG - Intergenic
914694539 1:150064907-150064929 GTTGAAGCCTTGAGCTCTGGTGG + Intergenic
916521097 1:165563996-165564018 GATGATTCCTTGAGCTCAGCAGG + Intergenic
916981281 1:170140101-170140123 GTTGAATCAATGAGAACACATGG + Intergenic
923443309 1:234041934-234041956 GATGGTGCCATGAGCTCAGAAGG - Intronic
923690198 1:236185061-236185083 ATTAAAACCATGAACTCAGACGG - Intronic
924033407 1:239910166-239910188 GTTCATTCTTTGAGCTCAGAGGG - Exonic
924306814 1:242698101-242698123 GTTGGAAGCATGAGCTCAGTGGG + Intergenic
924750731 1:246886639-246886661 GTAGAATCCATGGACACAGAGGG + Intronic
1062827227 10:581619-581641 GTTCCATCCATGGCCTCAGAGGG - Intronic
1063365974 10:5491142-5491164 GTGGAATTCAAGGGCTCAGAAGG - Intergenic
1064960997 10:20964825-20964847 GTTAAATTCAGGTGCTCAGATGG - Intronic
1065596528 10:27318824-27318846 GTTGAATGCATGAACTCTGCAGG - Intergenic
1066105954 10:32157269-32157291 CTTGAACCCAAGAGTTCAGAAGG + Intergenic
1069063290 10:63916317-63916339 TTTGATTCCTTTAGCTCAGAAGG - Intergenic
1073560160 10:104489453-104489475 GATGAAGACAGGAGCTCAGAGGG + Intergenic
1076429329 10:130390877-130390899 GGTGAAGCCAAGAGGTCAGAAGG + Intergenic
1079108430 11:17589189-17589211 TTTAAATTCATGGGCTCAGAAGG + Intronic
1080792699 11:35536023-35536045 GTTCAATCCAGCAGCGCAGAGGG - Intergenic
1081488392 11:43548389-43548411 GTGGAATGCAAGAGCACAGAGGG - Intergenic
1081862479 11:46341219-46341241 GTTGAATACAGGTGTTCAGAAGG - Intronic
1087734144 11:101812638-101812660 GTTGAAACTATGACCACAGAAGG - Intronic
1091276757 11:134358005-134358027 GTTCAATCCATGAGCCCAGGTGG - Intronic
1093962195 12:25286492-25286514 GTTGAAATCAAGAGCACAGAAGG - Intergenic
1095296808 12:40536104-40536126 TGTGATTCCATGAGCTCAGATGG + Intronic
1096185672 12:49578977-49578999 GCTTAGTCAATGAGCTCAGATGG - Intronic
1098141812 12:67457648-67457670 GCTGAATCCTTGACCCCAGAGGG - Intergenic
1099911357 12:88838399-88838421 TTTGAGTCCATGGGCTCATAGGG - Intergenic
1100727766 12:97427094-97427116 GTTGAAGCCATGTGCTGGGATGG + Intergenic
1105366986 13:19774471-19774493 GTTGAATCCATGGATACAGAGGG - Intronic
1111177424 13:84614526-84614548 GTTGTCTTCATGAGCACAGAGGG - Intergenic
1111844985 13:93496428-93496450 GATGAACCCATTACCTCAGATGG + Intronic
1112867883 13:103929718-103929740 TTTGAACCCCTGAGCTCAAAAGG + Intergenic
1115700750 14:35950371-35950393 GTGGAATTCAAGAGCACAGAAGG + Intergenic
1116201120 14:41798127-41798149 GTTGATTCCATGATCTAACAAGG - Intronic
1116840198 14:49812855-49812877 CTTGAACCCAGGAGCTGAGACGG - Intronic
1117090474 14:52245243-52245265 GTTGAAACCATGGGTACAGATGG + Intergenic
1119489287 14:75016843-75016865 TTTGCATCCATGGGCACAGAAGG - Exonic
1120199632 14:81522957-81522979 GTTGAATCCATGGATACAGAGGG + Intronic
1120676126 14:87423400-87423422 GATGAATCCAGTACCTCAGATGG - Intergenic
1126673377 15:51136613-51136635 TTTGAATCCAGGAGTTCAGAGGG - Intergenic
1133089872 16:3395772-3395794 GTGGACTGCCTGAGCTCAGAAGG + Intronic
1134246382 16:12543356-12543378 GTTCAGTCCATGAGCTTAGGTGG - Intronic
1135515424 16:23128442-23128464 CTTAAACCCATGAGCTCATAAGG + Intronic
1141937479 16:87251092-87251114 GCTGACTCCAGGAGCTGAGAGGG + Intronic
1144754818 17:17672984-17673006 GCTGAATCCAGGTGCCCAGAAGG + Intergenic
1148256579 17:46138270-46138292 ATTGAATCCATGAATACAGAGGG - Intronic
1150179598 17:63102812-63102834 GTTGAATCCATGAATTCAGAGGG - Intronic
1151401989 17:73861827-73861849 TTTGGCTCCATGAGTTCAGAGGG + Intergenic
1153914260 18:9732147-9732169 GATGAACCCAAGAGCTCTGAGGG - Intronic
1153978660 18:10291048-10291070 TGGGAAGCCATGAGCTCAGAGGG + Intergenic
1156238319 18:35226488-35226510 GGAGAATCCTTGAGCCCAGAAGG + Intergenic
1157045207 18:44094476-44094498 GGAGAATCCTTGAACTCAGAAGG + Intergenic
1157089888 18:44625082-44625104 TTTCTTTCCATGAGCTCAGATGG + Intergenic
1158811311 18:61039540-61039562 GTGGAAAACATGAGCTCAGTGGG - Intergenic
1161654719 19:5507201-5507223 CTGGAATCCATGGTCTCAGACGG - Intergenic
1165566547 19:36734244-36734266 CTTGACCCCATGAGTTCAGAGGG + Intronic
1167121383 19:47519326-47519348 GTTGATGCCATTAGCTCAGATGG - Intergenic
928021794 2:27711167-27711189 GTTGACTCCTTCAGCTCAGGTGG + Intronic
929686137 2:44036585-44036607 GTTGGGTCCATGTGATCAGATGG - Intergenic
932130656 2:69184327-69184349 GTTCAATCCATTACCCCAGAGGG - Intronic
932570934 2:72938078-72938100 GTTGAGTCCATGAGGACAGCAGG + Intergenic
934722801 2:96593408-96593430 CTGGAATCCATAACCTCAGAAGG - Exonic
934728638 2:96641977-96641999 TTTGAATTAATGAGCTCATATGG - Intronic
934937602 2:98476671-98476693 GTGGAAACCATGAGCGCAGAGGG - Intronic
943336425 2:186620536-186620558 GTTGATCCCTTGAGCTCAGGAGG + Intronic
944356151 2:198790694-198790716 TTAGAACACATGAGCTCAGAGGG + Intergenic
948098639 2:235356695-235356717 GCTGACTGCATGAGCTCAGTGGG - Intergenic
1172120276 20:32594336-32594358 GTTGAATCCAGGGGCTCAAAGGG - Intronic
1172397041 20:34615396-34615418 GTTAAAGAAATGAGCTCAGAGGG + Intronic
1174359689 20:50020274-50020296 GATGCCACCATGAGCTCAGAGGG + Intergenic
1176143449 20:63555032-63555054 GTGGAGTCCATGAGCTCACCAGG + Exonic
1176846432 21:13880184-13880206 GTTGAATACTTGTGATCAGAAGG - Intergenic
1178498403 21:33105911-33105933 GTTGAATACCTGATCTCTGAAGG - Intergenic
1180058464 21:45372543-45372565 GTTGAACCCATGAATACAGAGGG - Intergenic
1180736835 22:18023824-18023846 GGTGAACCCATGAGCTCATTAGG - Intronic
1182097127 22:27633509-27633531 GTTGAGTTCATGAGCAAAGAAGG - Intergenic
1183464298 22:37971945-37971967 CTTCAGTCCCTGAGCTCAGATGG + Intronic
1183734518 22:39636433-39636455 AATGAAGCCAGGAGCTCAGAGGG - Intronic
950455549 3:13090816-13090838 CTTCGATCCTTGAGCTCAGAAGG + Intergenic
952660661 3:35842667-35842689 GTGGAAGCCAGGAGATCAGATGG + Intergenic
953465522 3:43116027-43116049 GTTGGATCCAGGGACTCAGAGGG - Intergenic
955033422 3:55242599-55242621 GGATAATCCATTAGCTCAGATGG + Intergenic
958033748 3:88147073-88147095 GTTGAATAAATGAGCTTTGAAGG - Intronic
963807320 3:149736712-149736734 GTTTAATCCATAAGCTCATTAGG - Intronic
964244161 3:154631735-154631757 GTTGAATGAATGAATTCAGATGG + Intergenic
966257197 3:177930468-177930490 GGTGAAACCAAGAGCCCAGAGGG + Intergenic
967614863 3:191552579-191552601 GGTGAAGCCATGAGATCAGCAGG + Intergenic
967716906 3:192772886-192772908 ATTAAATCCATGAGCAGAGACGG - Intergenic
970410842 4:15806597-15806619 ATTGACTCCAGGTGCTCAGAGGG - Intronic
970467789 4:16344635-16344657 GTTGAATCCTCCAGCCCAGAGGG - Intergenic
971558081 4:28038824-28038846 GTTGAATCCCTGACCTCAAGAGG - Intergenic
971657478 4:29368583-29368605 GTTGAATTAATGAGCCCAAATGG - Intergenic
972235521 4:37129412-37129434 GTTAAATTCATGAGCACAGCTGG + Intergenic
972887898 4:43515448-43515470 ATTGAATTCATGAACACAGAGGG + Intergenic
973779483 4:54274871-54274893 ATTGAATCAATCAGCCCAGATGG + Exonic
973978905 4:56289967-56289989 TTGGACTCCATGAGCACAGAGGG + Intronic
974392571 4:61291232-61291254 GTGGAATCCATGGACACAGAGGG - Intronic
979564090 4:122134600-122134622 GTTGAATTAAGGAGCTCAGTAGG - Intergenic
980520139 4:133921161-133921183 GATGAATCAATGAGCAAAGATGG - Intergenic
981345056 4:143665130-143665152 GATGAATCCAGTACCTCAGATGG + Intronic
984916169 4:184726867-184726889 GTTGAACCCTTGACCTCAGGTGG - Intronic
986496250 5:8344642-8344664 GTTCAAGCCATGACCTCAGAGGG - Intergenic
986847440 5:11771910-11771932 GTTGGATTTATGAGCTCAGCAGG + Intronic
987296028 5:16552072-16552094 TGTGAATACATGACCTCAGATGG - Intronic
988932955 5:36054812-36054834 GGTGAAGCAATGAGCCCAGATGG - Intronic
989105018 5:37854772-37854794 GTTGAGTCCAGGAGCACAAAAGG - Intergenic
989544696 5:42659707-42659729 GATGAATGCAGTAGCTCAGATGG - Intronic
989604148 5:43227846-43227868 GTCTAATCCAGGATCTCAGAAGG + Intronic
989828456 5:45887150-45887172 GATGAATCCAGTACCTCAGATGG + Intergenic
1000207936 5:159080057-159080079 GTTGAAGCTATGGGCTTAGATGG - Intronic
1006389174 6:33748547-33748569 GAGGAATGCTTGAGCTCAGAAGG + Intergenic
1007368783 6:41412857-41412879 GTTGGAGCCTTGAGCTCAGGTGG + Intergenic
1011823734 6:91282179-91282201 GTTGAAGCCCTGAGCCCAAATGG + Intergenic
1012080925 6:94757856-94757878 GATGAATCCAGTACCTCAGATGG - Intergenic
1013665930 6:112348392-112348414 GTTGAGGCCAAGAGCACAGAAGG + Intronic
1014471260 6:121817478-121817500 TTTGAATCCATTAGCAGAGATGG + Intergenic
1015406615 6:132844572-132844594 GTTAGATCCTTAAGCTCAGATGG + Intergenic
1015760543 6:136655386-136655408 GATGAAGCCTTGAGCTCAGCAGG - Intronic
1016792080 6:148076644-148076666 GTTGAATGGAAGAGCACAGAAGG + Intergenic
1016983045 6:149870463-149870485 GATGAATCGATGAACTGAGAGGG - Intergenic
1021113446 7:16722367-16722389 GTTGATTCAAAGAGGTCAGAAGG - Intergenic
1021911600 7:25390715-25390737 GGTGAAGGCATGAGCTTAGAGGG + Intergenic
1023776531 7:43613184-43613206 GTTGAATCCATGGATGCAGAGGG - Intronic
1026454542 7:70559301-70559323 GTAGAAGCCATCAGATCAGATGG - Intronic
1031332360 7:120481737-120481759 GTTGAATCCACTACTTCAGAAGG + Intronic
1031896282 7:127352069-127352091 GTTGAATCCATGAGCTAATTAGG - Intronic
1033934736 7:146569944-146569966 GTTAAATGCATGAGCTCCCAAGG + Intronic
1034089726 7:148352651-148352673 GTTGAATCCATGAGCTCAGAGGG - Intronic
1036050092 8:5187111-5187133 GTTGAACCCAGTACCTCAGATGG - Intergenic
1036695807 8:10974411-10974433 GTTGAAACCACCCGCTCAGAGGG + Intronic
1038949457 8:32398628-32398650 CTTGAACCCCTGACCTCAGATGG + Intronic
1038973758 8:32668353-32668375 GTTACTTCCATGAGCTCAGTTGG - Intronic
1041831496 8:62160153-62160175 GTTTACTCCATGAACTGAGATGG + Intergenic
1043607961 8:82026124-82026146 GATGAATCTATGAGCTAAGGTGG - Intergenic
1043832119 8:85002060-85002082 GGTGAAACCATGAGCCCAGAGGG - Intergenic
1043920976 8:85983052-85983074 GTTGAATCCATGGATACAGAGGG + Intergenic
1044966623 8:97580057-97580079 GTTGAACTCTTGAGCTCAGGTGG - Intergenic
1045781569 8:105870484-105870506 TTTAAATCCATGAGTTCATAAGG - Intergenic
1045893347 8:107183771-107183793 TTTGAATCCTTGAGTTTAGAAGG + Intergenic
1047294764 8:123560895-123560917 GTTGAATCCGTGGGCTCAAACGG - Intergenic
1049121447 8:140742044-140742066 GTGGAATGCTTGAGCTCAGGAGG + Intronic
1051971725 9:22896114-22896136 CTTGAAGCAATGAGCTCAGTTGG + Intergenic
1052170867 9:25394895-25394917 GTTGAATGTATGAGATAAGAGGG + Intergenic
1055693694 9:78860177-78860199 GGTGAACCCATGTGCTCAGTTGG + Intergenic
1058110429 9:101026859-101026881 TTTGAATTCATGAACTAAGAGGG - Intergenic
1061801222 9:133114353-133114375 GTTTAAACCATCTGCTCAGATGG + Intronic
1062259523 9:135654162-135654184 TTTGAAGCCAAGAGCACAGAAGG - Intergenic
1186158998 X:6756897-6756919 ATTTCATCCATGAGATCAGAAGG + Intergenic
1186495408 X:10009128-10009150 GATGAATACAGGAGGTCAGATGG + Intergenic
1187277583 X:17829393-17829415 GGAGAATCTGTGAGCTCAGAGGG - Intronic
1187864858 X:23714837-23714859 GTAGATTCCTTGAGCTCAGGAGG - Intronic
1189936057 X:46069211-46069233 TTTAAATCCATGAGTTCATAAGG - Intergenic
1199743698 X:150758448-150758470 GTTGATGCCAGGAGCTCAGGTGG - Intronic
1201663821 Y:16427099-16427121 GATGAATCCAGTACCTCAGATGG - Intergenic
1202356401 Y:24054638-24054660 GCTGAATCCATGGAGTCAGAAGG - Intergenic
1202514377 Y:25615471-25615493 GCTGAATCCATGGAGTCAGAAGG + Intergenic