ID: 1034089730

View in Genome Browser
Species Human (GRCh38)
Location 7:148352673-148352695
Sequence TTTCTCCACCTGCAGCACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 280}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034089730_1034089739 5 Left 1034089730 7:148352673-148352695 CCCTTGTGCTGCAGGTGGAGAAA 0: 1
1: 0
2: 2
3: 25
4: 280
Right 1034089739 7:148352701-148352723 GGTAGGAGTATGGGGGGCTGTGG 0: 1
1: 0
2: 3
3: 47
4: 560
1034089730_1034089738 -1 Left 1034089730 7:148352673-148352695 CCCTTGTGCTGCAGGTGGAGAAA 0: 1
1: 0
2: 2
3: 25
4: 280
Right 1034089738 7:148352695-148352717 ACTGATGGTAGGAGTATGGGGGG No data
1034089730_1034089740 26 Left 1034089730 7:148352673-148352695 CCCTTGTGCTGCAGGTGGAGAAA 0: 1
1: 0
2: 2
3: 25
4: 280
Right 1034089740 7:148352722-148352744 GGCTTGCCCAAGTTCAACTTTGG 0: 1
1: 0
2: 1
3: 12
4: 81
1034089730_1034089735 -4 Left 1034089730 7:148352673-148352695 CCCTTGTGCTGCAGGTGGAGAAA 0: 1
1: 0
2: 2
3: 25
4: 280
Right 1034089735 7:148352692-148352714 GAAACTGATGGTAGGAGTATGGG 0: 1
1: 0
2: 1
3: 16
4: 165
1034089730_1034089736 -3 Left 1034089730 7:148352673-148352695 CCCTTGTGCTGCAGGTGGAGAAA 0: 1
1: 0
2: 2
3: 25
4: 280
Right 1034089736 7:148352693-148352715 AAACTGATGGTAGGAGTATGGGG No data
1034089730_1034089734 -5 Left 1034089730 7:148352673-148352695 CCCTTGTGCTGCAGGTGGAGAAA 0: 1
1: 0
2: 2
3: 25
4: 280
Right 1034089734 7:148352691-148352713 AGAAACTGATGGTAGGAGTATGG No data
1034089730_1034089737 -2 Left 1034089730 7:148352673-148352695 CCCTTGTGCTGCAGGTGGAGAAA 0: 1
1: 0
2: 2
3: 25
4: 280
Right 1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG 0: 1
1: 0
2: 1
3: 7
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034089730 Original CRISPR TTTCTCCACCTGCAGCACAA GGG (reversed) Intronic
900372753 1:2339541-2339563 TTTCTGCAGCTGCAGCAACAAGG + Intronic
901663916 1:10815850-10815872 TTTCCCCAGCTCCAGCCCAAAGG + Intergenic
902649679 1:17828889-17828911 TTTCTCCACCTTCAGCATGTAGG + Intergenic
902923670 1:19681913-19681935 TTTCTCCATCTGCACAACAAGGG + Intergenic
903953500 1:27010108-27010130 TTTCTCCAGCTGCAGCCAGAGGG - Intronic
905625430 1:39487659-39487681 TTTCTCCATCTGTAAAACAAAGG - Intergenic
908041324 1:60116732-60116754 TCTCTCCTGCTGCTGCACAATGG - Intergenic
909102470 1:71366977-71366999 TTTGTCCACCTGCAGAGTAATGG + Intergenic
909391471 1:75125949-75125971 ATTCTTTACATGCAGCACAATGG + Intergenic
909490103 1:76216616-76216638 TTTCTCCCCCTGCATCAAACAGG + Intronic
910500379 1:87883481-87883503 TTTCTCTACCGTCAGCATAAAGG + Intergenic
910763722 1:90760093-90760115 TTCCTCCTCCTTCAGGACAATGG + Intergenic
911472837 1:98339606-98339628 TTTCTTCACCTGCACCATCAGGG + Intergenic
912428303 1:109613617-109613639 TTTCTCCCCCTGGAGCTCAACGG + Exonic
913510105 1:119553629-119553651 TCTCACCACCTGCAGCCCCAGGG + Intergenic
914387891 1:147189446-147189468 TTTCTCCTCCTCCCACACAAAGG + Intronic
915367092 1:155322762-155322784 TTTCTTCGCCTGCGGGACAAGGG - Exonic
916438084 1:164795148-164795170 TTTCCTCACCTGCATCAAAATGG - Intronic
916754244 1:167753579-167753601 TTTGTCCAGCTGCAGCAGACTGG + Intronic
918182151 1:182093709-182093731 TTTCTCCACATGAGGCACACTGG - Intergenic
918866043 1:189901688-189901710 TTTCATCACATGTAGCACAATGG - Intergenic
919216886 1:194568030-194568052 CTTATGCACCTGAAGCACAAAGG - Intergenic
919570924 1:199246244-199246266 TTACTCCACCTGGAGAAAAATGG + Intergenic
919854596 1:201696522-201696544 TTTCTCCACCTCCAAGACATCGG - Intronic
920126000 1:203694271-203694293 TTTGTCCACCTCCTCCACAAGGG - Intronic
921094564 1:211875190-211875212 CTTCTCCTGCTGCAGCACACTGG - Intergenic
922808866 1:228404989-228405011 TTTCTTCACCTGCAAAAGAAAGG + Intronic
924931944 1:248739918-248739940 GTTCTTCACCTGCAGCACGGTGG + Intronic
1062863305 10:827512-827534 TCTCTTCAGCTGCAGAACAAAGG + Intronic
1064910020 10:20390529-20390551 TTTCCCCGCCTGGAGCAGAAAGG - Intergenic
1065112510 10:22453697-22453719 TTTCTTCATCTGCAAAACAAAGG + Intronic
1066260938 10:33729111-33729133 GTCCTCCACCTGAGGCACAAGGG + Intergenic
1067204203 10:44199621-44199643 TTGCCCCACCTGCAGAGCAATGG - Intergenic
1069911321 10:71761599-71761621 TGTCTGCACCTGCAGCTCCATGG + Exonic
1070580581 10:77716146-77716168 TTCCTCCAACTGCAGCAGACGGG + Intergenic
1070744258 10:78923375-78923397 CTCCTCCACCTCCAGCACAGTGG - Intergenic
1070927300 10:80233650-80233672 CTTCACGACCTGCAGAACAAGGG - Intergenic
1071241684 10:83713122-83713144 TTTCTCTACCTAAAGCACAAAGG + Intergenic
1071716806 10:88105129-88105151 TTCTTCAACCTGCAGCACACAGG - Intergenic
1072242363 10:93508615-93508637 TTACTCCACCTGCACCACAATGG + Intronic
1072452251 10:95547831-95547853 TTTCTCCTCATGCAGCAAAATGG + Intronic
1074285471 10:112093748-112093770 CTTCTCCTCCTGCAACAAAATGG + Intergenic
1075276089 10:121093942-121093964 TTTCTACAGGTGCAGCACTATGG + Intergenic
1075483138 10:122799215-122799237 TTTCCCCACATGCAGAACAGTGG + Intergenic
1075565658 10:123502033-123502055 GCTCTCCATCTGAAGCACAATGG - Intergenic
1075582571 10:123633494-123633516 TTTCTCTAACTGCAGAACACAGG - Intergenic
1077458511 11:2695709-2695731 CGTCCCCACCTGCAGCACACAGG + Intronic
1079260152 11:18870906-18870928 CTTCTCTAACTGCAGCAAAAAGG + Intergenic
1081915814 11:46729466-46729488 GTTCACCACCTGCAGGACACTGG - Exonic
1082125004 11:48422043-48422065 TTTGTCCACCTGCACCCCAGAGG - Intergenic
1082210810 11:49498807-49498829 GGTCTCCAACTGCAGCACAAAGG - Intergenic
1083471055 11:62884302-62884324 CTTCCCCACCTGCACTACAAAGG - Intronic
1083713243 11:64561330-64561352 TTTCCCCATCTGTAACACAAGGG - Intronic
1086638829 11:89125982-89126004 GGGCTCCAACTGCAGCACAAAGG + Intergenic
1089113041 11:116072170-116072192 TCTCCCCTCCTGCAGCCCAAGGG - Intergenic
1089301964 11:117504336-117504358 TCTCTCCACCTGCAGCCAACTGG - Intronic
1090624828 11:128597575-128597597 TTTCTACACCAGCAGCATACAGG - Intergenic
1090877540 11:130804478-130804500 TTTCTCCATCTGGAGCCCATTGG - Intergenic
1090911003 11:131119372-131119394 CTTCTCCACCTGCATCTCATGGG - Intergenic
1091828047 12:3529763-3529785 TTTCTCCACCTTCAGCTCAATGG + Intronic
1095838848 12:46669795-46669817 TGGCTCCAGCTGCAGCTCAAAGG - Intergenic
1101458500 12:104863393-104863415 TTTCCCCAGCTGAAGCACAGTGG - Intronic
1101837338 12:108304696-108304718 TTTCTCCACCTCCTGCACACCGG + Intronic
1104122720 12:125814563-125814585 TTGCTCCACCAGCAGCACTGAGG - Intergenic
1104873589 12:132017520-132017542 TTTCTCCACGGGCAGCACTCAGG + Exonic
1105052129 12:133064099-133064121 TTTGTCCACTTACATCACAATGG + Intergenic
1105576917 13:21662199-21662221 TTTCTCCACCTAGATCTCAAAGG - Intergenic
1106841706 13:33691235-33691257 TTTCTACACCAACAGCTCAATGG + Intergenic
1107640406 13:42437304-42437326 TTTCTTCATCTGCAACATAAGGG - Intergenic
1108059279 13:46516478-46516500 TTTCTCTACGTGCTGCAGAAGGG - Intergenic
1108595279 13:51943963-51943985 TATCTCCGCCTGCTGCAGAAGGG + Intronic
1108710113 13:53024890-53024912 TTTCCCCACCACCATCACAAGGG - Intergenic
1109944491 13:69415244-69415266 GTTCTTCATCTGGAGCACAATGG - Intergenic
1111854722 13:93623410-93623432 TTTCTCTACTTCCAGGACAATGG + Intronic
1112186841 13:97135958-97135980 TCTCTCCACCTCCAGCATATTGG - Intergenic
1114719390 14:24864220-24864242 TTTCTCCACAAGAAGCTCAAAGG + Intronic
1117831788 14:59758618-59758640 TTTCTCCATCTCCACCCCAAGGG + Intronic
1118986097 14:70756108-70756130 TTTCTCCACCGAAAGAACAAGGG - Intronic
1119979403 14:79062421-79062443 TTTTTCCAAATACAGCACAATGG + Intronic
1121525909 14:94619180-94619202 TTGCTCCACCTTCAGCCAAATGG + Exonic
1121683667 14:95815596-95815618 TTTCCTCACCTGCTGCACAGAGG + Intergenic
1122196753 14:100093541-100093563 TATCTACAACTGCAGTACAAAGG - Intronic
1122812558 14:104296283-104296305 GTTCACCACCTGCAGCTCAGGGG - Intergenic
1124871049 15:33543080-33543102 TTGCTACTCCTACAGCACAAAGG - Intronic
1125153428 15:36560285-36560307 CCTCTCCACTTGCAGCACCATGG - Intergenic
1125538394 15:40455897-40455919 CTCCTCCACCTCCAGCACAGGGG + Intronic
1126555605 15:49984476-49984498 TTTCTCCACCTGAGCCAGAAGGG + Intronic
1127249021 15:57210168-57210190 TTATTGCACCTGCAGCACAGAGG + Intronic
1128370174 15:67034545-67034567 TGTCCCCAGCTGCAGGACAATGG - Intergenic
1128634591 15:69294886-69294908 TTCCCCCACTGGCAGCACAAGGG - Intergenic
1130296990 15:82654374-82654396 TTTCCCCAGCTGCAAAACAAAGG - Intergenic
1130825687 15:87543637-87543659 TTTCTCCATCTGTAAGACAAAGG - Intergenic
1130850978 15:87793284-87793306 TCTCTCCAACTTCAGCAAAAAGG - Intergenic
1130859497 15:87874038-87874060 TTTCCCCATCTGCAGAATAAGGG - Intronic
1131423065 15:92323348-92323370 TTTATTCTCCTGCAGCACCAGGG + Intergenic
1131485661 15:92818140-92818162 TTTCTACACCTTCATCAGAATGG - Intergenic
1131522881 15:93129716-93129738 TTTCTCCCACTGCAGCTCATTGG - Intergenic
1133886846 16:9837618-9837640 TTTCTTAACCTCCAGGACAAAGG + Intronic
1135857243 16:26023000-26023022 TTTCCCCACCTGGAGTGCAATGG - Intronic
1138554938 16:57765517-57765539 ATCATCCACCTGCTGCACAAGGG - Exonic
1140910512 16:79447231-79447253 TTTCTCCACTTACAGCACCTAGG - Intergenic
1143514875 17:7414557-7414579 TTCCTCCACATCCAGCAGAATGG + Intronic
1143682844 17:8490502-8490524 TTCCTCCACCTGCTGCTCTAGGG + Exonic
1143789257 17:9280511-9280533 TTTCCCCAGCTGGAGCGCAATGG - Intronic
1147133035 17:38419993-38420015 TTTCTCCAAATGCACCCCAAAGG + Intergenic
1147136105 17:38434958-38434980 TTCCTCCACCTTGAGCATAAGGG - Intronic
1147267515 17:39243890-39243912 ATCATCCTCCTGCAGCACAAAGG + Intergenic
1149528467 17:57376530-57376552 TTTCTCCAACTCCAGAACACGGG - Intronic
1150442398 17:65202135-65202157 TATCTTCACCTCAAGCACAATGG - Intronic
1153796425 18:8627166-8627188 TTACACCAGCAGCAGCACAAGGG - Intronic
1154029273 18:10737237-10737259 CTTCTCCACATGTAACACAAGGG + Intronic
1155424842 18:25696212-25696234 TTTCACAACTTGCAGCACATTGG + Intergenic
1156272017 18:35544414-35544436 TTTCTCTGCCTGCAGAACCAAGG + Intergenic
1156344718 18:36246693-36246715 TTTCACCACCTGCAACACCCTGG - Intronic
1158311148 18:56159868-56159890 TTTCAAAACCTGGAGCACAATGG + Intergenic
1161152468 19:2716932-2716954 TTTTCCCATCTGCAGGACAAGGG + Exonic
1161353950 19:3808960-3808982 CTTCTCCACCAGCAGCTCCATGG + Exonic
1161595566 19:5149517-5149539 CTTCTCCCCCTGGAGCAGAACGG + Intronic
1161596862 19:5154936-5154958 CCTCCCCACCTGCAGCACACAGG - Intergenic
1163249774 19:16119623-16119645 TTTCTCCACTTCCAGCACGTTGG + Intronic
1163636352 19:18438700-18438722 TTTCCCCACCTGCAGCAGGAGGG + Intergenic
1165176562 19:33934723-33934745 TTTCTCCAACTGCAGCTCTTAGG - Intergenic
1165806802 19:38585251-38585273 TTTCTCCATCTGCAAAACGAGGG + Intronic
1166720030 19:44991301-44991323 CTTCTGTACCTGGAGCACAAGGG + Exonic
1168116890 19:54227173-54227195 TTGCTCCATCTGAAGTACAATGG + Intronic
1168333654 19:55584761-55584783 TTTCTCCTCCTCCTCCACAAAGG + Intergenic
925213730 2:2073901-2073923 TTTCTCCACCCTCAGCACTCTGG + Intronic
926233260 2:11020739-11020761 TTTCTCCCTCTCCATCACAAAGG + Intergenic
926688748 2:15718312-15718334 TTTCTCCACCTGCTGAACTCAGG - Intronic
927388660 2:22567255-22567277 TTCATACACCTGCAGCACTATGG - Intergenic
928734211 2:34266999-34267021 TTTCTCTACCTTTAGAACAAGGG + Intergenic
929374751 2:41272455-41272477 TTTATCCACGGGCTGCACAATGG + Intergenic
933417883 2:82010336-82010358 TTTCTTCACCTGTAGAACAAAGG - Intergenic
934158539 2:89226156-89226178 TTTCCCCACCTGGACCTCAATGG + Intergenic
934159818 2:89238116-89238138 GTTCTCCACCTGGACCTCAATGG + Intergenic
934207461 2:89944319-89944341 GTTCTCCACCTGGACCTCAATGG - Intergenic
934208734 2:89956271-89956293 TTTCCCCACCTGGACCTCAATGG - Intergenic
935489766 2:103703270-103703292 TTTCTCCACCTCCATCAGTAAGG - Intergenic
939245720 2:139621118-139621140 TTTCACCACCTGCAACACCTTGG - Intergenic
940332558 2:152491025-152491047 TGTCCCCACCAACAGCACAATGG - Intronic
942446804 2:176083529-176083551 TTGTTCAACCTGCAGCACACGGG - Exonic
943253110 2:185555882-185555904 TTTCTGCACCTGCAGAATCAAGG - Intergenic
943445293 2:187977868-187977890 TTCCTCCTCCTGCAACACCAGGG - Intergenic
945586244 2:211667190-211667212 TTTCCCAACCTGCAGCCCATTGG - Intronic
946142544 2:217703981-217704003 TGCCTCCACCTGCAGCTCACAGG + Exonic
946744987 2:222836632-222836654 TTGCTCAAGCTGGAGCACAATGG - Intergenic
947444510 2:230153718-230153740 TTTCTCTAGCTGCAGCAGAAGGG - Intergenic
947991817 2:234494704-234494726 TGTCACCACTTGCAGCATAAAGG + Exonic
948359460 2:237409128-237409150 TTTCTTCATCTGAAGCATAAAGG + Intronic
948775290 2:240284851-240284873 TTTCTCCACCTGCACAGCCAAGG - Intergenic
948810767 2:240476575-240476597 TGTCTCCACCTGCAGCTCTGTGG - Intergenic
948938452 2:241183707-241183729 TTTCTCCTCCTGCAGAATGAGGG + Intergenic
949028134 2:241775767-241775789 TACCTCCACCTGCAGCCCAGGGG - Intergenic
1169145154 20:3247710-3247732 TTACACCACCAGCAGCACCAGGG - Intergenic
1169921790 20:10741984-10742006 TTTCTTCTCCTGCAGAAGAATGG - Intergenic
1173178180 20:40781154-40781176 TTTCACCACCTTCATCACCAGGG - Intergenic
1173750153 20:45470012-45470034 TCTCTCCACCTCCAGCACATTGG - Intronic
1174279635 20:49429787-49429809 TTTCTTCACCTGGATAACAAGGG - Intronic
1175302240 20:57951232-57951254 TTTCCCCATCTGCATAACAAAGG + Intergenic
1175625235 20:60484037-60484059 CTTCACCACCTGCAGTAGAAAGG - Intergenic
1175765581 20:61590383-61590405 TTCCTGCACCTGCAGCAGGAGGG + Intronic
1176284387 21:5011785-5011807 CTCCTCCACCTGCAGGACAGAGG - Intergenic
1177757064 21:25360785-25360807 TGCCTCCAGCTGCAGCACAAGGG + Intergenic
1179872794 21:44251690-44251712 CTCCTCCACCTGCAGGACAGAGG + Exonic
1180019889 21:45116231-45116253 TTTCTCCATCTTCAGCCCCAGGG + Intronic
1180604549 22:17047310-17047332 CTTCACCACCTGCAGAACGAGGG - Intergenic
1180756244 22:18163874-18163896 CGTCTCCACCTGCACCTCAAGGG - Intronic
1180870919 22:19146901-19146923 CTTGTCCACCTGCACCACACTGG - Intergenic
1180926580 22:19559369-19559391 CTCCTCCTCCTGCAGCTCAAGGG + Intergenic
1181861092 22:25818741-25818763 CTTCTCCACCTGCAAAACCAAGG - Intronic
1182271161 22:29154455-29154477 TTTGTCCACCTGCAGCATTGGGG - Intronic
1182977853 22:34640296-34640318 TATCTCCCCCTGCATCACAGTGG - Intergenic
1183075753 22:35425864-35425886 TTTCTCCACCTGTAAAACAGAGG - Intergenic
1183450711 22:37893378-37893400 TTTCTCCACCAGCAAGAGAAGGG + Intergenic
1184267553 22:43357337-43357359 TTTCTCCGTCTGCAAAACAAAGG - Intergenic
1184805291 22:46791467-46791489 TTTTTCCACCTGGAACACAGAGG - Intronic
949420198 3:3857232-3857254 TTTCTCCATCTGCAAAACAAGGG - Intronic
950362845 3:12462152-12462174 TTTCTCCATCTGCAAGTCAAGGG + Intergenic
951752343 3:26051237-26051259 TTTCTCTACCTGAAACCCAATGG - Intergenic
952060191 3:29498674-29498696 TATCTACACCTGCAATACAAAGG + Intronic
952125325 3:30293010-30293032 TTTCTCTTCCCACAGCACAAAGG + Intergenic
952853256 3:37746432-37746454 TTTCCCCACCTGAAAAACAATGG + Intronic
953202162 3:40787335-40787357 CTGCTCCAGCTGCAGCTCAAAGG + Intergenic
953999182 3:47542667-47542689 TTTCTCCATCTGTAGAACAAGGG + Intergenic
954464622 3:50647160-50647182 TTTGTCCTCCTGCAGCACTCGGG - Exonic
955096448 3:55803033-55803055 TTTCCCCAGCTTCAGAACAATGG - Intronic
955533750 3:59901329-59901351 TTGCTTCACCTGCAAGACAAAGG + Intronic
956070268 3:65441919-65441941 TTTCATCACCAGCAGCATAAAGG + Intronic
956374184 3:68596619-68596641 TTTGTCCATCTGCAGCTCAGAGG - Intergenic
957416879 3:79917012-79917034 TTTCTCCACATTCAGCAAATAGG + Intergenic
959157982 3:102689721-102689743 TTTCTTCAGCTTCAGTACAAAGG - Intergenic
961710361 3:128823703-128823725 TTTCTCCACCTTCAGTGCCATGG + Intergenic
961994493 3:131227697-131227719 TTTCTCCTCCCCCAGCCCAAGGG + Intronic
963844517 3:150141549-150141571 TTCCTCCACCTGCAGCTTAAGGG - Intergenic
964914883 3:161828490-161828512 TTTCTGCCCCTACAGCTCAAAGG + Intergenic
966256144 3:177918129-177918151 TTTGACAACCAGCAGCACAAAGG + Intergenic
966924846 3:184637704-184637726 TTGCTCCACCTGCAACCCCACGG - Intronic
967086278 3:186097858-186097880 TTTTTCCACGGGCTGCACAATGG + Intronic
968570239 4:1336235-1336257 TTTCAACACCTGCAGGACAAGGG - Intronic
969099051 4:4755257-4755279 TTTCCCCATCTGCACCACCAGGG - Intergenic
969378590 4:6779592-6779614 TTTCCCCATCTGCACAACAAGGG - Intergenic
971237320 4:24854538-24854560 TTTCTTCAGCTGCAGCAGGAAGG - Intronic
971572873 4:28235951-28235973 GTTCTCCCCTTGCAGCTCAAAGG + Intergenic
972871422 4:43304524-43304546 TTTCCCCACCTATAACACAATGG + Intergenic
975181528 4:71351263-71351285 TTTCTTCACATGCAGCTAAAGGG + Intronic
976206199 4:82625709-82625731 TTTGTCCACCCACAGCACAGGGG + Intergenic
978466999 4:109018603-109018625 ATTCTACACTTGCAGCACCAGGG + Intronic
979601509 4:122590991-122591013 TTTCTCCACCTACATTTCAAAGG - Intergenic
980184083 4:129439905-129439927 TGTCTCCACCAGCAAAACAAGGG + Intergenic
980599917 4:135009197-135009219 TTTCTCCATCTGGAGTACAGTGG + Intergenic
982785923 4:159536919-159536941 TGTCTCCATCTGCATCCCAAAGG - Intergenic
983732368 4:171011728-171011750 TTGCTCCAGCTCCAGCTCAAAGG + Intergenic
985099464 4:186443642-186443664 TTTCTTCATCTGTAACACAAAGG - Intronic
986026141 5:3853159-3853181 TCTAGTCACCTGCAGCACAACGG + Intergenic
986627440 5:9735836-9735858 TATCTCCATATGCAGCATAATGG - Intergenic
989243240 5:39223923-39223945 TTTCTCCACCTGGAGAAGAGGGG - Intronic
990365270 5:55064190-55064212 TTGCCCCAACTGAAGCACAAAGG - Intergenic
990808885 5:59699776-59699798 TTTTTCAACCTGTAGCAAAAAGG + Intronic
991355310 5:65762945-65762967 TTTCTCCATCTGCAGTGGAAAGG + Exonic
991408893 5:66327725-66327747 TTTCTTCACCTGAAACAGAAGGG + Intergenic
994046216 5:95313253-95313275 TTTCTCCACCTGCTGCTGGAAGG - Intergenic
995785271 5:115821003-115821025 TTTCTCCTCCTCCTGAACAATGG + Intergenic
995863666 5:116667175-116667197 TTTCTGCTCCTGCAGCAGAAAGG - Intergenic
998294429 5:140953418-140953440 TTTCTCCAGCTTAAGGACAAAGG - Intronic
999065553 5:148682196-148682218 ATTCTGCAGCTGTAGCACAAAGG - Intergenic
999717816 5:154376090-154376112 TTTCTCCATCTGTAGTACACAGG + Intronic
999774412 5:154800559-154800581 TTTCTCCATCTGCAGATGAAAGG + Intronic
999909604 5:156183201-156183223 TTTTTCCACCTCTAGGACAATGG - Intronic
1000152109 5:158513350-158513372 TTTCTCCACGTGTATCACTATGG - Intergenic
1002711697 5:181198797-181198819 TTGCTACACCTGCAGGACAAGGG + Exonic
1003161917 6:3643512-3643534 ATTTTTCACCTGCAGCAAAAAGG - Intergenic
1003720816 6:8700217-8700239 CTTCTCCACCTACAGAACTATGG + Intergenic
1004538023 6:16521653-16521675 TGTCTGCACCTGCAGAAGAATGG - Intronic
1005347257 6:24902796-24902818 CTTCTCCTCCTGCAGAACATTGG - Intronic
1005798561 6:29393958-29393980 TCTCTGCACCTGCAGCATAAGGG - Intronic
1006151203 6:31991178-31991200 TCTCCCCACCTGCAAGACAAAGG - Exonic
1006157504 6:32023916-32023938 TCTCCCCACCTGCAAGACAAAGG - Exonic
1006609946 6:35288437-35288459 TTTCCCCACATGCAGGACCATGG - Intronic
1007231860 6:40353767-40353789 TTTCTCCACCTCCATGTCAAGGG - Intergenic
1007269491 6:40625559-40625581 TCTCTTCACCTCCAGCACTAAGG + Intergenic
1009309252 6:62129112-62129134 TTTATCCATCTGCAGCAAGATGG - Intronic
1010428003 6:75748236-75748258 TTTCTCCACCCACAGAACCATGG + Intergenic
1010476040 6:76288712-76288734 TCTCTCCACATGAATCACAAAGG + Intergenic
1010541297 6:77095146-77095168 TTTCTCCACCCTCAGAAAAAGGG - Intergenic
1011741019 6:90360724-90360746 TTTCTCCATCTGTAAAACAAGGG + Intergenic
1012738772 6:102985942-102985964 TTTCTTCACCTGTATAACAAAGG - Intergenic
1013956860 6:115852294-115852316 TTTCACAACCTGCAGAACAGGGG + Intergenic
1015872505 6:137791290-137791312 TTTCTCAACCTGCAGCTTACGGG + Intergenic
1016848225 6:148590538-148590560 TTTTTCCTCCTTCAGCTCAAGGG + Intergenic
1017130159 6:151101550-151101572 CTTCTCCAACTGCAGCAAAAAGG - Exonic
1020709680 7:11591393-11591415 TTTCTCCACCTCAAGGAAAATGG + Intronic
1022362445 7:29675092-29675114 TTTCTCTGCCTCCAGCAGAAAGG - Intergenic
1022428844 7:30295214-30295236 TTTCTCTACCTCCAGCAGAAAGG + Intronic
1022498805 7:30869813-30869835 TCTCCCCTCCTGCAGCACGAGGG - Intronic
1022643371 7:32208644-32208666 TTTCTCCACCTGGTGCATAGTGG + Intronic
1022698955 7:32738656-32738678 TTTCTCTACCTCCAGCAGAAAGG + Intergenic
1023122807 7:36926262-36926284 GTTCTTCACCTGCAAAACAAAGG - Intronic
1023979621 7:45061029-45061051 TTTATCCCCCAGCATCACAAGGG - Intronic
1024048445 7:45601176-45601198 CTTCTCCACCAGCTGCACAGGGG - Intronic
1028293033 7:89092066-89092088 TTTCTCAGCCTCCAGAACAATGG - Intronic
1032294230 7:130621446-130621468 ATTCTGTAGCTGCAGCACAAAGG + Intronic
1033261385 7:139846856-139846878 TTTCTAAACCTGCCGCACTATGG - Intronic
1033277523 7:139983914-139983936 TTTCTCCACTGGCAGCTCCAAGG - Intronic
1033486349 7:141792716-141792738 TTTCTCTACCTACAATACAAAGG - Intergenic
1033847308 7:145449071-145449093 TTGCTCAAGCTGGAGCACAACGG - Intergenic
1034089730 7:148352673-148352695 TTTCTCCACCTGCAGCACAAGGG - Intronic
1035225724 7:157431111-157431133 TCACTCCACAGGCAGCACAAGGG - Intergenic
1036384350 8:8265616-8265638 TTTCTTCACATGCAGCAGCAAGG + Intergenic
1038340720 8:26683017-26683039 TTCTTCCACCTGCAGCCCCACGG - Intergenic
1039310115 8:36308423-36308445 CTTCTCCAACTGCACCAAAAAGG - Intergenic
1039749660 8:40465446-40465468 TTTTTCCATCTTCAGAACAATGG - Intergenic
1039989060 8:42472646-42472668 TGTCTCCTCCTGTAGCAGAAAGG + Exonic
1048012332 8:130467913-130467935 TTTCTCCATCTGAATTACAACGG + Intergenic
1048591875 8:135827881-135827903 TGTCTCTGCATGCAGCACAAAGG + Intergenic
1049265213 8:141664232-141664254 TTTCTCCACCTGTAACTCAAAGG - Intergenic
1049428134 8:142546523-142546545 TTTCTCCACCTGCTTCCCAGGGG - Intergenic
1049848812 8:144819935-144819957 CTTCTTCACCAGCAGCCCAAGGG + Intergenic
1050087219 9:1978529-1978551 CTTCTTCATCTGCAGGACAAGGG + Intergenic
1051839720 9:21381727-21381749 TTTATCCACATGCTGCAAAAAGG - Intergenic
1052755203 9:32533863-32533885 TTTCTCATCCTCCAGCACATTGG - Intergenic
1052877241 9:33576085-33576107 TGGCTCCATCTGCAGCACAGTGG - Intergenic
1053004457 9:34594699-34594721 TTTCTCTGTCTGCAGCATAAGGG - Intergenic
1053498761 9:38568309-38568331 TGGCTCCATCTGCAGCACAGTGG + Intronic
1053536993 9:38936051-38936073 TTTGTACACCTGCCACACAAAGG + Intergenic
1053598856 9:39590361-39590383 TTGCTGAAGCTGCAGCACAATGG + Intergenic
1053856609 9:42344878-42344900 TTGCTGAAGCTGCAGCACAATGG + Intergenic
1054629143 9:67427879-67427901 TTTGTACACCTGCCACACAAAGG - Intergenic
1059344977 9:113621801-113621823 TTTCTCCATCTGCAGAATGAGGG + Intergenic
1060289835 9:122291534-122291556 TTTTTCCTCCTGCAGTACAGTGG + Intronic
1060579496 9:124731627-124731649 TTTCTCCTCCTTCAGCATGAAGG + Intronic
1061677721 9:132227837-132227859 CTTCTCCACTTGCAGCCCAGGGG - Intronic
1062055738 9:134468954-134468976 TTTCTCCCCCTGCACCACGGGGG + Intergenic
1062530398 9:136997071-136997093 GTTCCCCATCTGCAGCACCAGGG + Intergenic
1185603851 X:1355775-1355797 TCTGCCCACCTGCAGCACACTGG - Intronic
1186778232 X:12887335-12887357 TTCCTCCACCAGCAGGACCATGG + Exonic
1188628348 X:32316044-32316066 ATTCTCAACCTGCAGTTCAATGG - Intronic
1191608158 X:63083599-63083621 TCTCTCCACAAGCAGCACAGAGG - Intergenic
1192223968 X:69215891-69215913 TTCCTCTACCTGCAGCTCAGTGG - Intergenic
1194214393 X:91110644-91110666 TTCCACCACCTGCAACACCATGG - Intergenic
1196147881 X:112340009-112340031 TCTCTCTACCTGTAGCTCAAGGG - Intergenic
1200249004 X:154542268-154542290 TTTCCCCACCTGGATCACAAGGG - Exonic
1200886489 Y:8277185-8277207 TTTTACCACTTACAGCACAATGG - Intergenic
1200908444 Y:8509551-8509573 GTTTCCTACCTGCAGCACAAGGG - Intergenic
1201017494 Y:9621273-9621295 TTTTACCACCTACAGTACAATGG - Intergenic
1201480679 Y:14436196-14436218 TTTCCCCACATGCAGGACAGAGG - Intergenic
1201982972 Y:19927213-19927235 TTGCTCCAGCTGGAGCACAATGG - Intergenic
1202108922 Y:21401582-21401604 TTTGACCATTTGCAGCACAATGG - Intergenic
1202197649 Y:22310845-22310867 TTTGACCACTTGCAGCACAATGG + Intronic