ID: 1034089731

View in Genome Browser
Species Human (GRCh38)
Location 7:148352674-148352696
Sequence GTTTCTCCACCTGCAGCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 328}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034089731_1034089737 -3 Left 1034089731 7:148352674-148352696 CCTTGTGCTGCAGGTGGAGAAAC 0: 1
1: 0
2: 3
3: 25
4: 328
Right 1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG 0: 1
1: 0
2: 1
3: 7
4: 134
1034089731_1034089735 -5 Left 1034089731 7:148352674-148352696 CCTTGTGCTGCAGGTGGAGAAAC 0: 1
1: 0
2: 3
3: 25
4: 328
Right 1034089735 7:148352692-148352714 GAAACTGATGGTAGGAGTATGGG 0: 1
1: 0
2: 1
3: 16
4: 165
1034089731_1034089740 25 Left 1034089731 7:148352674-148352696 CCTTGTGCTGCAGGTGGAGAAAC 0: 1
1: 0
2: 3
3: 25
4: 328
Right 1034089740 7:148352722-148352744 GGCTTGCCCAAGTTCAACTTTGG 0: 1
1: 0
2: 1
3: 12
4: 81
1034089731_1034089739 4 Left 1034089731 7:148352674-148352696 CCTTGTGCTGCAGGTGGAGAAAC 0: 1
1: 0
2: 3
3: 25
4: 328
Right 1034089739 7:148352701-148352723 GGTAGGAGTATGGGGGGCTGTGG 0: 1
1: 0
2: 3
3: 47
4: 560
1034089731_1034089736 -4 Left 1034089731 7:148352674-148352696 CCTTGTGCTGCAGGTGGAGAAAC 0: 1
1: 0
2: 3
3: 25
4: 328
Right 1034089736 7:148352693-148352715 AAACTGATGGTAGGAGTATGGGG No data
1034089731_1034089734 -6 Left 1034089731 7:148352674-148352696 CCTTGTGCTGCAGGTGGAGAAAC 0: 1
1: 0
2: 3
3: 25
4: 328
Right 1034089734 7:148352691-148352713 AGAAACTGATGGTAGGAGTATGG No data
1034089731_1034089738 -2 Left 1034089731 7:148352674-148352696 CCTTGTGCTGCAGGTGGAGAAAC 0: 1
1: 0
2: 3
3: 25
4: 328
Right 1034089738 7:148352695-148352717 ACTGATGGTAGGAGTATGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034089731 Original CRISPR GTTTCTCCACCTGCAGCACA AGG (reversed) Intronic
901817088 1:11800536-11800558 TATTCTCCACCGCCAGCACAGGG - Intronic
902243766 1:15105702-15105724 GTTTCCCCACCTGTATAACATGG - Intronic
902481703 1:16715522-16715544 GTGTCTCCACCAGCAGCTCCTGG - Intergenic
902611310 1:17598993-17599015 GTTTCCCCACCTGTAGAATAGGG + Intronic
902923669 1:19681912-19681934 ATTTCTCCATCTGCACAACAAGG + Intergenic
903308119 1:22428965-22428987 GTTTCCCCAACCTCAGCACATGG - Intergenic
903646315 1:24898245-24898267 CTCTCTCCACCTGCTGCCCAGGG + Intergenic
904391993 1:30192068-30192090 GTTTCTCCTTCTGTAACACAAGG - Intergenic
905288697 1:36906345-36906367 GTTTCTCCACCTGCAAGATGGGG + Intronic
905361224 1:37422236-37422258 GTTGCTTCACCTGTAGAACAGGG + Intergenic
905409551 1:37758940-37758962 CTTTCTCCTCCTGTATCACATGG + Intronic
905904714 1:41610359-41610381 TTTTCTCCTCCTACAGGACAGGG + Intronic
906883026 1:49613379-49613401 GTTTCTCAACCTCCAGGCCATGG + Intronic
907163030 1:52385448-52385470 GTTTCTCCACCCAAATCACATGG + Intronic
909190403 1:72542474-72542496 GTTTCTCCATCTGTGGGACATGG - Intergenic
910679553 1:89848412-89848434 GTTTTTCCCACTGCAGAACAGGG - Intronic
911472836 1:98339605-98339627 GTTTCTTCACCTGCACCATCAGG + Intergenic
912417395 1:109519177-109519199 GATTCCCCACCCGAAGCACATGG + Intergenic
913106068 1:115615166-115615188 CTCACTCCATCTGCAGCACAGGG + Intergenic
916312784 1:163415456-163415478 CTTTCTCCACCAGCAGCATTTGG + Intergenic
920126001 1:203694272-203694294 GTTTGTCCACCTCCTCCACAAGG - Intronic
920499539 1:206477538-206477560 GTGTCTCTACCTGAAGCAAAGGG + Intronic
923443571 1:234045465-234045487 GTTTCTTCACCTGCAAAGCAAGG - Intronic
1064037385 10:11925834-11925856 GTATGTCCACCTGCACCACAGGG + Intronic
1064291676 10:14040086-14040108 GTTTCTCCATCTGTAAAACAAGG - Intronic
1064604291 10:17022588-17022610 GTTTCTCCGCCTGCAGGAGAGGG - Intronic
1068678624 10:59794493-59794515 GGGTCTTCACGTGCAGCACATGG - Exonic
1070523972 10:77279079-77279101 TCTTCACCACCTGCAGCACTGGG + Intronic
1070580580 10:77716145-77716167 CTTCCTCCAACTGCAGCAGACGG + Intergenic
1071449470 10:85780431-85780453 GTTTCTCATCCTGCACCACGGGG + Intronic
1074857261 10:117482526-117482548 GTGTCCCCATCTCCAGCACATGG - Intergenic
1075166096 10:120069638-120069660 GTTTCCACATCTGCAGAACAGGG + Intergenic
1075390250 10:122086389-122086411 ATTTCCCCACCTGCAGCTCCTGG - Exonic
1078475660 11:11627432-11627454 GTTTCTTCACCTGCAAAATAGGG + Intergenic
1079120767 11:17683209-17683231 GTTTCTAAACCTACAGGACAGGG + Intergenic
1080239427 11:30109639-30109661 GTTCCTGCACATGCAGCTCAGGG - Intergenic
1083191126 11:61053007-61053029 CTTTCTCCACCTGCTGCCCCAGG - Intergenic
1083479294 11:62933533-62933555 GCTTCTCCACCTGCTGCAGGTGG - Intergenic
1083713244 11:64561331-64561353 GTTTCCCCATCTGTAACACAAGG - Intronic
1083746534 11:64740066-64740088 GTTTGACCACCTGGAGCCCATGG - Exonic
1083934737 11:65864347-65864369 GCCTCTCCACCTGCCTCACAGGG - Intronic
1084188890 11:67490025-67490047 GGCTCTCCACCTGCAGGGCATGG - Exonic
1084326189 11:68401555-68401577 GTTTCTCCACCTGTAACTGAGGG - Intronic
1085218589 11:74853335-74853357 ATTTCTCTACCTCTAGCACACGG + Intronic
1085275532 11:75296469-75296491 CATTCCCCACCTGCAGCATAGGG + Intronic
1085467747 11:76735676-76735698 CCTCCTCCACCTGAAGCACATGG + Intergenic
1086294242 11:85347259-85347281 GTTTCTCCCCCTGAAGCACAGGG + Intronic
1086915178 11:92522023-92522045 GTTCCTCCAATGGCAGCACAGGG + Intronic
1088116698 11:106320451-106320473 GCTTGTCCACCTGCAACAAATGG + Intergenic
1088726415 11:112640617-112640639 ATTTCACCACCTCCAGCACTCGG - Intergenic
1088881463 11:113976426-113976448 GTTCCTCCACTTGCAGAGCAAGG + Intronic
1088908114 11:114170044-114170066 GTTTCTCAACCTCCAGGCCAAGG - Intronic
1089318457 11:117607994-117608016 CTCTCTCCACCTGCATCAGAGGG + Intronic
1089753462 11:120668508-120668530 GATTCCCCACCTGAAACACAGGG - Intronic
1090006474 11:123007229-123007251 GTCTCTCCACTTTGAGCACAGGG + Intergenic
1090638975 11:128714330-128714352 GTTTCCTCAACTGCAGAACAGGG + Intronic
1090911004 11:131119373-131119395 GCTTCTCCACCTGCATCTCATGG - Intergenic
1092025917 12:5240374-5240396 GTTTGTCCATCTGCAAAACAAGG - Intergenic
1093362894 12:18254039-18254061 GTTTCTCCACTTTAAGCACTAGG - Intronic
1093595074 12:20949865-20949887 GTTTTTCCATCTGCAGACCATGG - Intergenic
1094491389 12:30963124-30963146 GTTTCTCCTCCTGCAGTCCCAGG + Intronic
1094822702 12:34239110-34239132 GTTTCCTCAACTGAAGCACAGGG - Intergenic
1095347660 12:41170649-41170671 GTTTGTTCATCTGTAGCACAGGG - Intergenic
1095501497 12:42844980-42845002 ATTTCTTCAGCTGCAGCAAATGG - Intergenic
1096530315 12:52238530-52238552 GTTTCTACAGCTGCTGTACATGG - Intronic
1096604503 12:52754969-52754991 GTTTTTCAACCTGCTGCCCAGGG + Intergenic
1101173212 12:102120791-102120813 GTTTCTTCACCTGCAAAACCAGG - Intronic
1102782111 12:115574287-115574309 GTTTCTTCATCTGCATAACAGGG - Intergenic
1103825819 12:123737124-123737146 TTTTCTTCACCTGGATCACACGG - Exonic
1105230622 13:18491905-18491927 GGTTCTCCTCCTGCAGTTCAGGG - Intergenic
1105451518 13:20504001-20504023 GTTTCTCCACCATCTGTACATGG - Intronic
1107758468 13:43651090-43651112 GCTGCTCCACCCACAGCACATGG + Intronic
1108112849 13:47095340-47095362 GTGTCTCCATCTGAAGCAAAGGG - Intergenic
1112773434 13:102817905-102817927 GTTTCTCAGCCTACAGCAAAGGG - Intronic
1112856054 13:103770682-103770704 GTTTCTCTCCCTAGAGCACATGG - Intergenic
1114014871 14:18418717-18418739 GGTTCTCCTCCTGCAGTTCAGGG - Intergenic
1115115439 14:29876106-29876128 GTTTCTCCCTCTGAAGCAAATGG - Intronic
1117163394 14:53010944-53010966 GTTTCCCCACCTGCTTTACATGG - Intergenic
1117212689 14:53517536-53517558 GTTTCTCCACCTCCTGTGCAAGG + Intergenic
1117265901 14:54086497-54086519 GTTTCTCCACCTGAAGGCTAAGG - Intergenic
1118603806 14:67488612-67488634 CTCTCTCCACCAGCACCACAAGG + Intronic
1118756750 14:68850507-68850529 GTTTCCTCATCTGCAGCACAGGG + Intergenic
1122123350 14:99566325-99566347 GTTTCCCCACCTGTAAAACAGGG - Intronic
1122289102 14:100670186-100670208 GTTTCCCCATCTGCAGCATGGGG + Intergenic
1122812559 14:104296284-104296306 TGTTCACCACCTGCAGCTCAGGG - Intergenic
1123066117 14:105620274-105620296 GTTTCTCCTCCTGCTGGGCACGG - Intergenic
1123070261 14:105639327-105639349 GTTTCTCCTCCTGCTGGGCACGG - Intergenic
1123074851 14:105662986-105663008 GTTTCTCCTCCTGCTGGGCACGG - Intergenic
1123089498 14:105736111-105736133 GTTTCTCCTCCTGCTGGGCACGG - Intergenic
1123095286 14:105764271-105764293 GTTTCTCCTCCTGCTGGGCACGG - Intergenic
1124507178 15:30288165-30288187 CTTTGTCCACATGCAGCCCATGG - Intergenic
1124736379 15:32250494-32250516 CTTTGTCCACATGCAGCCCATGG + Intergenic
1125538393 15:40455896-40455918 GCTCCTCCACCTCCAGCACAGGG + Intronic
1126212923 15:46120193-46120215 GTTTCTGCAGCTGTGGCACATGG + Intergenic
1126555604 15:49984475-49984497 GTTTCTCCACCTGAGCCAGAAGG + Intronic
1126795023 15:52253708-52253730 GTGTCACCACCAGCACCACATGG + Intronic
1128515284 15:68338125-68338147 GTTTCCTCACTTCCAGCACAGGG + Intronic
1128538843 15:68511085-68511107 CATTCTCCACCTGCAGCCCCGGG - Intergenic
1129355196 15:74986199-74986221 GTTGCTCCTCCTGGAGCACCTGG + Intronic
1130867210 15:87943164-87943186 GTTCCTGCACCAGCAGCACCTGG - Intronic
1134098383 16:11434745-11434767 GTTTCTCCACCTGCTTCTTAGGG - Intronic
1134330985 16:13251045-13251067 GTTTCTTCACCTGCACGATAGGG + Intergenic
1135100161 16:19598135-19598157 GTTTCTCCACCTGTAGAATGGGG + Intronic
1135106318 16:19653075-19653097 GTTTCTCCATCTGAAGGGCAAGG + Intronic
1137295790 16:47092153-47092175 GTTTCTCCAACAACAGCAAATGG - Intronic
1137553949 16:49458528-49458550 GTTCATCCACCTGCTGCCCAAGG + Intergenic
1140897912 16:79341266-79341288 GTTTCTCCATCTATATCACAGGG + Intergenic
1141637333 16:85321296-85321318 GTTTCAGAAGCTGCAGCACAAGG + Intergenic
1143383318 17:6509697-6509719 GAGTCTCAACCTGCAGCTCAGGG - Intronic
1143726494 17:8850446-8850468 GTTTCCCCATCTGCAGAACTGGG - Intronic
1144268470 17:13594337-13594359 GTTTCTGCGCCTGCAGTCCAGGG - Intronic
1144480846 17:15627856-15627878 GTTTCTCCATCTGCAAAATAAGG + Intronic
1144747719 17:17626759-17626781 GTTTCCCCATTTGCACCACAGGG - Intergenic
1144917514 17:18736200-18736222 GTTTCTCCATCTGCAAAATAAGG - Intergenic
1146852735 17:36237379-36237401 CCTTCTCCACCTACAGCCCAAGG + Intronic
1146868645 17:36361271-36361293 CCTTCTCCACCTACAGCCCAAGG + Intronic
1147071519 17:37961897-37961919 CCTTCTCCACCTACAGCCCAAGG + Intergenic
1147083046 17:38041421-38041443 CCTTCTCCACCTACAGCCCAAGG + Intronic
1147098989 17:38165394-38165416 CCTTCTCCACCTACAGCCCAAGG + Intergenic
1147136106 17:38434959-38434981 GTTCCTCCACCTTGAGCATAAGG - Intronic
1149528468 17:57376531-57376553 GTTTCTCCAACTCCAGAACACGG - Intronic
1150080524 17:62234435-62234457 CCTTCTCCACCTACAGCCCAAGG + Intergenic
1150495759 17:65606815-65606837 GTCTCTCCGCCTGCAGAATAGGG - Intronic
1150550238 17:66203413-66203435 GATTCTCCCTCTGCACCACATGG - Intergenic
1151085779 17:71378913-71378935 GTTGCCCCACCAGAAGCACAGGG - Intergenic
1152530799 17:80917985-80918007 GTTCCTGCACCTCCACCACAAGG + Intronic
1153318413 18:3747911-3747933 GTTTCTGCATCCGGAGCACATGG - Intronic
1153796426 18:8627167-8627189 GTTACACCAGCAGCAGCACAAGG - Intronic
1154522783 18:15247963-15247985 GGTTCTCCTCCTGCAGTTCAGGG + Intergenic
1157983449 18:52409837-52409859 GTTTCTCCAACTGCAAAATAAGG - Intronic
1160874624 19:1291297-1291319 GTTTACCCTCCTGCACCACAAGG + Intronic
1161152467 19:2716931-2716953 GTTTTCCCATCTGCAGGACAAGG + Exonic
1161838802 19:6666043-6666065 GTTTCCCCACCTGCAAAAGAGGG - Intronic
1162448952 19:10742803-10742825 GTTTCCCCATCTGCAAAACAGGG + Intronic
1163585632 19:18161987-18162009 GCTTCTCCACCAGCAGCGCCGGG - Exonic
1163636351 19:18438699-18438721 GTTTCCCCACCTGCAGCAGGAGG + Intergenic
1163741032 19:19012570-19012592 GTTTCTCCATCTGTAAGACAGGG + Intronic
1163827751 19:19533091-19533113 GTTTCCCCACCTGCAGAACAGGG - Intronic
1165429659 19:35765271-35765293 GTTTCTCCAGCTGTAAAACAGGG + Intronic
1165484413 19:36086727-36086749 TCTTCTCCACGTTCAGCACATGG - Exonic
1165806801 19:38585250-38585272 GTTTCTCCATCTGCAAAACGAGG + Intronic
1166761702 19:45228221-45228243 CTTCGTCCTCCTGCAGCACACGG + Exonic
1167696736 19:51019510-51019532 GTTTCTCCACCTGCGGGACGCGG - Intronic
1168355901 19:55699511-55699533 GTTTCTCAAACTGCAGCCCAAGG + Intronic
1202715742 1_KI270714v1_random:41434-41456 GTGTCTCCACCAGCAGCTCCTGG - Intergenic
925570685 2:5309493-5309515 GTTTATCCATCTGCGGCACGTGG + Intergenic
925640817 2:5984493-5984515 GCTTCTTCAGCTGCAGAACAGGG + Intergenic
926161946 2:10495533-10495555 GCATCTTCACGTGCAGCACAGGG - Intergenic
927653476 2:24926731-24926753 GCTTCTCCACCCGCACAACAGGG - Intergenic
928460475 2:31467736-31467758 CTTTTTCCACCTGCAGAGCAGGG - Intergenic
929476758 2:42258504-42258526 GATTCTCCTGCTGCAGCACCCGG + Intronic
931756732 2:65381458-65381480 GTTTCTCTATCTGCAAAACAGGG + Intronic
931776529 2:65545749-65545771 GTATCTCCTCCTGCCACACATGG + Intergenic
933833299 2:86227367-86227389 GCTGCTCCACCTGCAGGACCTGG - Intronic
933983663 2:87573561-87573583 CTGTCTCCACCTGCAGAGCAGGG + Intergenic
934936607 2:98470276-98470298 GTCTCCCCACCTGCACCACTGGG - Intronic
935098500 2:99970011-99970033 GTTTCTTCTCCTGCAGCATTCGG - Intronic
936627170 2:114160855-114160877 GTATCTCCAACTGCACCAAAGGG - Intergenic
936962055 2:118086580-118086602 GTTACTCCTACTGCAGTACAAGG - Intergenic
938522069 2:132080815-132080837 GGTTCTCCTCCTGCAGTTCAGGG + Intergenic
941651408 2:168096373-168096395 GTCTCTTCACCTGTAACACACGG + Intronic
941736392 2:168981425-168981447 ATTTCTTCATCTGCAACACAGGG + Intronic
942446805 2:176083530-176083552 TTTGTTCAACCTGCAGCACACGG - Exonic
943343102 2:186705121-186705143 GTGACTGCTCCTGCAGCACAGGG + Intronic
944581398 2:201135983-201136005 GTTTCTCCAACTCAACCACAAGG - Exonic
944654968 2:201868310-201868332 GTTTTCCCACCTGCAGAAGAGGG - Intronic
944684968 2:202110062-202110084 GTGTCTCCCCCAGGAGCACAGGG - Intronic
945910533 2:215643922-215643944 GTCTTTCCACCTAGAGCACAAGG - Intergenic
947444511 2:230153719-230153741 CTTTCTCTAGCTGCAGCAGAAGG - Intergenic
947485278 2:230542186-230542208 TTTTCTCCACATGCACTACAGGG - Intronic
947907688 2:233777483-233777505 GTATCTCCAAGTGCAGAACAAGG + Intronic
948251323 2:236532192-236532214 GTTACTCCACCTGCAGAGCAAGG + Intergenic
949028135 2:241775768-241775790 TTACCTCCACCTGCAGCCCAGGG - Intergenic
1170139827 20:13114184-13114206 GTTTCTTCATCTGTAACACAGGG + Intronic
1172136590 20:32690506-32690528 GTTGCAGCACCTGCAGCCCACGG - Intergenic
1172847597 20:37939066-37939088 GTTTCTTCACCTGCATCATAGGG + Intronic
1173635258 20:44550726-44550748 GTTTCTCCATCTGTAACATAAGG - Intronic
1173660338 20:44729035-44729057 ATTTCTCCTCTTGCATCACACGG - Intergenic
1174868519 20:54161784-54161806 ATTTCTCCTCCTGCTCCACAAGG - Intronic
1175125634 20:56749387-56749409 GTTTCTCCACCTGCAACAGAAGG - Intergenic
1175689037 20:61052658-61052680 GCTTCCCCAGCTGCTGCACAGGG - Intergenic
1175976727 20:62714231-62714253 GTGTCCTCACCTGCAGCGCAGGG + Intronic
1176727653 21:10454209-10454231 GTGTCGGCTCCTGCAGCACAAGG - Intergenic
1176774613 21:13120252-13120274 GGTTCTCCTCCTGCAGTTCAGGG - Intergenic
1176873256 21:14101070-14101092 GTTTCCTCAACTGAAGCACAGGG - Intergenic
1177171390 21:17659753-17659775 GTTCCTCCACCTCAAGCACAGGG - Intergenic
1177757063 21:25360784-25360806 CTGCCTCCAGCTGCAGCACAAGG + Intergenic
1179564451 21:42237943-42237965 GTTTTTGCATCTGCAGAACAGGG + Intronic
1179818543 21:43923189-43923211 GTGTCCCTTCCTGCAGCACAAGG - Intronic
1180376217 22:12096437-12096459 GCTTCTGCTCCTGCAGGACAGGG + Intergenic
1180439370 22:15349490-15349512 GGTTCTCCTCCTGCAGTTCAGGG - Intergenic
1180926579 22:19559368-19559390 GCTCCTCCTCCTGCAGCTCAAGG + Intergenic
1181602474 22:23960583-23960605 CTTTATCCACCTGCTGCACCTGG - Intronic
1181606039 22:23980724-23980746 CTTTATCCACCTGCTGCACCTGG + Intronic
1182271162 22:29154456-29154478 ATTTGTCCACCTGCAGCATTGGG - Intronic
1182356129 22:29722971-29722993 GTCTCTGCACCTTCAGCTCATGG + Intronic
1183065894 22:35362367-35362389 GTTTCCACACCTGCATAACAAGG - Intergenic
1183080003 22:35450295-35450317 GTTTCCCAATCTGCAGAACAGGG + Intergenic
1183450710 22:37893377-37893399 GTTTCTCCACCAGCAAGAGAAGG + Intergenic
1183453177 22:37907302-37907324 ATTTCACAACCTGCAGCACCCGG - Intronic
1184071878 22:42151813-42151835 GTTTCTCCTCTGGCAGCCCAGGG - Intergenic
1184143136 22:42591401-42591423 GCTTCTCCACTTCTAGCACAGGG + Intronic
1184530233 22:45050959-45050981 GTTTCTTCACCTGTAAAACAGGG + Intergenic
1203225170 22_KI270731v1_random:73809-73831 TTCTCTCCACGTGCTGCACAGGG - Intergenic
949207107 3:1453470-1453492 GTATCTCCACCAGCAACACAAGG - Intergenic
949420199 3:3857233-3857255 GTTTCTCCATCTGCAAAACAAGG - Intronic
950424164 3:12915614-12915636 GCTTCTCCACCTTCTGCACCTGG + Exonic
950455226 3:13088760-13088782 GTTTCTCCAGCTCCAGCTCCAGG + Intergenic
950569191 3:13789525-13789547 GTTTCCCCATCTGTAGAACAAGG + Intergenic
951312216 3:21141080-21141102 CTTCCTCCTCCTGCAGCACTTGG - Intergenic
952092852 3:29911269-29911291 TGTTCACCAGCTGCAGCACATGG - Intronic
953823960 3:46233935-46233957 GCTTCCCCATCTGCAACACAGGG + Intronic
953999181 3:47542666-47542688 GTTTCTCCATCTGTAGAACAAGG + Intergenic
954435253 3:50492524-50492546 GTTTCCCCATCTGTACCACACGG + Intronic
954435391 3:50493209-50493231 GAATCTCCACCTCCAGCCCAAGG + Intronic
954464623 3:50647161-50647183 CTTTGTCCTCCTGCAGCACTCGG - Exonic
954464659 3:50647300-50647322 CTTTCTATACCTGGAGCACAGGG + Intronic
955643700 3:61113881-61113903 TGTTCCTCACCTGCAGCACACGG + Intronic
956378909 3:68645126-68645148 CTTACTCCCCCTGCAGCTCAGGG + Intergenic
960301530 3:116008823-116008845 CTTTCTCCACCTGTAGTCCAGGG + Intronic
961559053 3:127716273-127716295 GTTTCTTCACCTGTAAGACAGGG + Intronic
961844267 3:129747862-129747884 GTTTCTGCTACTGCAGGACATGG - Intronic
962555463 3:136546310-136546332 GTTTCTTGACCTGTGGCACATGG + Intronic
963332802 3:143934288-143934310 GTTTTTCCACCTGTAACATAGGG - Intergenic
963844518 3:150141550-150141572 GTTCCTCCACCTGCAGCTTAAGG - Intergenic
964444777 3:156747557-156747579 GTCTTGCTACCTGCAGCACAAGG - Intergenic
966381459 3:179348460-179348482 GTTTCTCAACCTGAAGCTCTAGG - Intronic
966928806 3:184662614-184662636 GTTTCTCTATTTGCACCACAAGG + Intronic
967324272 3:188223692-188223714 GTTTCTACAACAGCAGCAAAGGG - Intronic
968090852 3:195897366-195897388 GTCTCTCCATCTCCAGGACACGG + Intronic
968376720 4:50085-50107 GGCTCTCCTCCTGCAGCTCAGGG + Intergenic
968478300 4:822985-823007 GTTTCTCCAGCAGCAGCAACCGG - Intronic
968570240 4:1336236-1336258 ATTTCAACACCTGCAGGACAAGG - Intronic
968730760 4:2268243-2268265 GTTTCCCCACCTACAACACGGGG + Intergenic
968967951 4:3778841-3778863 ATTTCTCCAGCTGTAGCCCAAGG + Intergenic
969099052 4:4755258-4755280 GTTTCCCCATCTGCACCACCAGG - Intergenic
969246264 4:5934978-5935000 GTTTCTCCAGCTGTAAAACATGG + Intronic
969254108 4:5990913-5990935 GTTTCCTCACCAGCTGCACAGGG + Intergenic
969378591 4:6779593-6779615 GTTTCCCCATCTGCACAACAAGG - Intergenic
969639250 4:8387257-8387279 GTTTCCTCATCTGCAGCACGGGG - Intronic
969930543 4:10626913-10626935 GTTTCTTCACCTGTAAAACAGGG + Intronic
971220696 4:24703532-24703554 GTTTCTTCACCTACACCATATGG + Intergenic
975851693 4:78579331-78579353 GTTTCTTCACCTGTAGGATAAGG + Intronic
976206198 4:82625708-82625730 TTTTGTCCACCCACAGCACAGGG + Intergenic
976398263 4:84581326-84581348 TTTTTTCCTCCTGCAGCAAAGGG + Intergenic
976774620 4:88694188-88694210 GTTCCTGAACCTGCAGCACTAGG - Intronic
977167008 4:93711733-93711755 CATTCTCCATCTGCACCACATGG + Intronic
978804069 4:112782553-112782575 GTTTCTTCACCTGTAGCATGGGG - Intergenic
980184082 4:129439904-129439926 GTGTCTCCACCAGCAAAACAAGG + Intergenic
980247953 4:130271848-130271870 GTATCCCCACCTGCAGTACAAGG - Intergenic
982573035 4:157074852-157074874 ATTTTTCCACCCGCAGCATATGG - Intergenic
983054648 4:163087246-163087268 CTTTCTCCCCCTGCAGCGCTCGG - Intergenic
983352092 4:166602746-166602768 GTTTCCCCACCTGAGGCCCATGG - Intergenic
983352323 4:166606394-166606416 GTTTCCCCACTTGAAGCCCATGG + Intergenic
985089666 4:186350310-186350332 GTTTGTCCAACTGCGGCCCATGG + Intergenic
985183626 4:187292469-187292491 GTTTCTCCGCCTCAAGCAGAGGG - Intergenic
986917205 5:12635776-12635798 TTTTCTGAACTTGCAGCACATGG + Intergenic
989192471 5:38684727-38684749 ATTTCCCCACCTGCAGAACTAGG + Intergenic
989243241 5:39223924-39223946 GTTTCTCCACCTGGAGAAGAGGG - Intronic
989412792 5:41139876-41139898 TTTTCTCCATCTGCATCCCATGG - Intergenic
990382589 5:55231851-55231873 GCACCTCCACCTGCAACACAGGG + Exonic
990899841 5:60738532-60738554 GATTCTCTATCTGCACCACATGG - Intergenic
992021918 5:72633219-72633241 GTTTCTCCTGCTGCAACATAAGG + Intergenic
993589519 5:89777737-89777759 CTTTTTCCACCTGTAACACATGG + Intergenic
996524061 5:124459093-124459115 GTTTCTCAACCTGCAGGGCTGGG + Intergenic
997628802 5:135350553-135350575 GTTTCTTCACCTGCCCCACAAGG - Intronic
997753827 5:136375643-136375665 ATTACTCAACCTGCAGCAGATGG + Intronic
997868056 5:137482234-137482256 GTTTCTACAGCTGCTGCTCATGG - Intronic
998513176 5:142730555-142730577 CTTTCTCCTCCTCCAGCCCATGG + Intergenic
999622364 5:153486251-153486273 GTTTCTCCATCTGCAAAATATGG - Intergenic
999767478 5:154752568-154752590 GTTTCTTCATCTGCAAAACAAGG + Intronic
999795472 5:154985406-154985428 CTTTTTCCACCTTCAGCACTTGG - Intergenic
1000052850 5:157576869-157576891 GTTTCTCCACCTGGAAAATAAGG - Intergenic
1001222744 5:169916401-169916423 GTTTCTTCAGCTCCAGAACAGGG - Intronic
1001438560 5:171720114-171720136 CTTTCTCCACCTCCCTCACAGGG + Intergenic
1002016115 5:176324275-176324297 GTTTCTTCATCTGCAAAACAGGG + Intronic
1002316602 5:178348178-178348200 GCCTCTCCACCTGCCGCCCAGGG + Intronic
1002711696 5:181198796-181198818 ATTGCTACACCTGCAGGACAAGG + Exonic
1004311114 6:14545937-14545959 GTTTCTCCATCTGTAAGACAGGG + Intergenic
1005798562 6:29393959-29393981 CTCTCTGCACCTGCAGCATAAGG - Intronic
1006358649 6:33575338-33575360 GTTGCAGCACCTGCAGCCCACGG - Exonic
1006445784 6:34079091-34079113 GTTTCTCCACCTGTAGTATGGGG - Intronic
1006844252 6:37051536-37051558 GTGTCTCCTCCTGCCGCACGCGG - Intergenic
1007317006 6:40997119-40997141 GTCTTCCCTCCTGCAGCACAAGG - Intergenic
1007664385 6:43505789-43505811 GGTTCACCACCTGCACCGCAAGG + Exonic
1009452868 6:63822006-63822028 GTTTTGCTACCTACAGCACATGG - Intronic
1009994787 6:70886109-70886131 GTTTCTTCATCTGCAGAACAGGG - Intronic
1012108016 6:95190694-95190716 GTTTCTACACATGCATCACTGGG - Intergenic
1012644686 6:101664251-101664273 GTTTGTACAGCTGCTGCACATGG - Intronic
1013746596 6:113353366-113353388 GTTTTTCCTCATGCATCACAAGG - Intergenic
1013956859 6:115852293-115852315 TTTTCACAACCTGCAGAACAGGG + Intergenic
1015872504 6:137791289-137791311 TTTTCTCAACCTGCAGCTTACGG + Intergenic
1017024814 6:150172458-150172480 GCCTCCCCACCTGCACCACAGGG - Intronic
1018933017 6:168254501-168254523 GTTTCTCCACCTGTAAACCAAGG + Intergenic
1019495231 7:1335240-1335262 GTTTCTACACCTGGAAAACAAGG - Intergenic
1019915676 7:4130649-4130671 GTTTCTGGACCTGAATCACAAGG + Intronic
1020061285 7:5154445-5154467 GTTTCCCCAGGTGCAGAACAGGG - Intergenic
1020166817 7:5813833-5813855 GTTTCCCCAGGTGCAGAACAGGG + Intergenic
1022498806 7:30869814-30869836 GTCTCCCCTCCTGCAGCACGAGG - Intronic
1024048446 7:45601177-45601199 GCTTCTCCACCAGCTGCACAGGG - Intronic
1024618836 7:51139624-51139646 GTTTCTCAACCTTCAACCCATGG + Intronic
1026490299 7:70857147-70857169 GTTTATCCACCTGCTGCCTATGG - Intergenic
1031220500 7:118958764-118958786 ATTTCTCCAGCTGGAGCCCAGGG - Intergenic
1032544149 7:132727928-132727950 CTTCCTCCACCTGCACCACTAGG + Exonic
1033416048 7:141162087-141162109 CTTTCTCCACCTGCAGGGCTTGG + Intronic
1034047953 7:147949753-147949775 GTTTCCTGACCTGCAGCCCAGGG - Intronic
1034089731 7:148352674-148352696 GTTTCTCCACCTGCAGCACAAGG - Intronic
1035091965 7:156320136-156320158 GATTCTCCAGCTGCAGCCAAGGG - Intergenic
1035113396 7:156503866-156503888 AGTTCCCCATCTGCAGCACAAGG + Intergenic
1035663555 8:1364285-1364307 CTGTCCCCACCTGGAGCACAGGG - Intergenic
1035704723 8:1666894-1666916 GTGTTTCCACCTGCAGCAGCCGG + Intronic
1036583577 8:10101200-10101222 ATTTCTTCATCTGCAGAACAGGG + Intronic
1036638081 8:10565094-10565116 GTATGTCCACCTCCAGCATAGGG - Intergenic
1039446333 8:37636138-37636160 GTTTCCCCACCTGCAAAGCAAGG + Intergenic
1039827911 8:41190433-41190455 TTAACTCCACCTGCAACACATGG - Intergenic
1040410380 8:47148294-47148316 GTTTTTACACTTGCAGTACATGG + Intergenic
1041725790 8:61016296-61016318 GGTACTCAACCTGTAGCACATGG + Intergenic
1044531578 8:93313626-93313648 GTTTCTTCATCTGCAGAATATGG + Intergenic
1047436609 8:124840156-124840178 GTCTATCCACGTGAAGCACATGG - Intergenic
1047730542 8:127724411-127724433 GTTTCTCAATCTGCAGAAAATGG - Intergenic
1049037198 8:140086049-140086071 CTTTCCCCACCTGAAGCAGAAGG + Intronic
1049428135 8:142546524-142546546 CTTTCTCCACCTGCTTCCCAGGG - Intergenic
1049602618 8:143514951-143514973 GTGTCTGCTCCTGCAGGACAAGG + Intronic
1050097028 9:2077405-2077427 GGTTCTCCACCTGCATAAAATGG + Intronic
1051361077 9:16282193-16282215 GTTTCTGCCCCAGCAGCACCTGG + Intergenic
1053004458 9:34594700-34594722 GTTTCTCTGTCTGCAGCATAAGG - Intergenic
1053426358 9:38012723-38012745 GGTACGCCACCTGCGGCACACGG + Intronic
1053533352 9:38903472-38903494 GTTTCTTCATCTGTAGAACAGGG + Intergenic
1053700764 9:40687945-40687967 GGTTCTCCTCCTGCAGTTCAGGG + Intergenic
1054205578 9:62127901-62127923 GTTTCTTCATCTGTAGAACAGGG + Intergenic
1054312057 9:63487343-63487365 GGTTCTCCTCCTGCAGTTCAGGG + Intergenic
1054410831 9:64811400-64811422 GGTTCTCCTCCTGCAGTTCAGGG + Intergenic
1054632783 9:67460469-67460491 GTTTCTTCATCTGTAGAACAGGG - Intergenic
1055138884 9:72852620-72852642 GTTTTTCCGCCTGCAGCAATGGG - Intergenic
1055573646 9:77641708-77641730 GTTCCCCCACCTCCAGTACAGGG - Intronic
1055826466 9:80331241-80331263 CTTCCTCCACCAGAAGCACAGGG - Intergenic
1059433773 9:114264723-114264745 GGTTCTCCACCTGGAGCAGCTGG + Intronic
1061268208 9:129520752-129520774 GTGTCTCCATCTGTAACACAGGG + Intergenic
1061677722 9:132227838-132227860 CCTTCTCCACTTGCAGCCCAGGG - Intronic
1061953344 9:133948825-133948847 GTTTCTCCACCTGTAGACCAGGG - Intronic
1062055737 9:134468953-134468975 GTTTCTCCCCCTGCACCACGGGG + Intergenic
1062442112 9:136575473-136575495 GTTTCCCCATCTGTACCACAGGG - Intergenic
1203538605 Un_KI270743v1:66741-66763 GCTTCTGCTCCTGCAGGACAGGG + Intergenic
1203572510 Un_KI270744v1:144161-144183 GGCTCTCCTCCTGCAGCTCAGGG - Intergenic
1186521900 X:10213668-10213690 GTAACTCCACCTGCAACAGAGGG - Exonic
1187527522 X:20067557-20067579 GTTTCTACACCTGTAAGACAAGG - Intronic
1190763076 X:53452629-53452651 GTTTCCACAGCTGCAACACAAGG - Intergenic
1191764778 X:64685735-64685757 TTTTTTGCACCTGTAGCACATGG + Intergenic
1192807609 X:74524180-74524202 GCTTCCCCATCTGCAACACAGGG + Intronic
1194053485 X:89101299-89101321 CATTCTCCAGCTGGAGCACAGGG - Intergenic
1194481005 X:94424431-94424453 GTTGCTCCACCTCCAGCATTAGG - Intergenic
1196147882 X:112340010-112340032 GTCTCTCTACCTGTAGCTCAAGG - Intergenic
1196678197 X:118442856-118442878 GTTTCTTCATTTGCAGAACAGGG - Intronic
1199462860 X:148102828-148102850 GTTTCTCCAGCTGCATAACAGGG - Intergenic
1199649197 X:149937471-149937493 GTTTCTTTACCTGCACAACAAGG + Exonic
1200249005 X:154542269-154542291 GTTTCCCCACCTGGATCACAAGG - Exonic
1201431382 Y:13906243-13906265 GTTTCTCCCACTGCAAGACAGGG - Intergenic