ID: 1034089737

View in Genome Browser
Species Human (GRCh38)
Location 7:148352694-148352716
Sequence AACTGATGGTAGGAGTATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 134}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034089727_1034089737 19 Left 1034089727 7:148352652-148352674 CCTCTGAGCTCATGGATTCAACC 0: 1
1: 0
2: 1
3: 13
4: 263
Right 1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG 0: 1
1: 0
2: 1
3: 7
4: 134
1034089731_1034089737 -3 Left 1034089731 7:148352674-148352696 CCTTGTGCTGCAGGTGGAGAAAC 0: 1
1: 0
2: 3
3: 25
4: 328
Right 1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG 0: 1
1: 0
2: 1
3: 7
4: 134
1034089726_1034089737 20 Left 1034089726 7:148352651-148352673 CCCTCTGAGCTCATGGATTCAAC 0: 1
1: 0
2: 1
3: 10
4: 149
Right 1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG 0: 1
1: 0
2: 1
3: 7
4: 134
1034089730_1034089737 -2 Left 1034089730 7:148352673-148352695 CCCTTGTGCTGCAGGTGGAGAAA 0: 1
1: 0
2: 2
3: 25
4: 280
Right 1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG 0: 1
1: 0
2: 1
3: 7
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034089737 Original CRISPR AACTGATGGTAGGAGTATGG GGG Intronic
901200378 1:7463668-7463690 AACAGATGGTGGGAGTAGGTGGG + Intronic
904382579 1:30121343-30121365 ATCTGAAGGTAGGAGCATTGTGG + Intergenic
905358283 1:37400332-37400354 AAATGATGGTAAGATCATGGAGG + Intergenic
907225080 1:52938538-52938560 AAATGATGAAAGGAGCATGGCGG - Intronic
907723776 1:56999760-56999782 ATCTGATGGCAGGAGTCTTGGGG - Intronic
908559064 1:65286633-65286655 AAAAGATGGTAGGAGTGTGTTGG + Intronic
908914201 1:69107255-69107277 AACTGATGGTATGAGAAGGCAGG + Intergenic
912185263 1:107267653-107267675 ACCTGAGGGCAAGAGTATGGTGG - Intronic
913116305 1:115700773-115700795 AACTGATGTTCGAGGTATGGAGG + Exonic
914772223 1:150697977-150697999 AAAGGCTGGTAGGAGGATGGGGG - Intergenic
916581646 1:166114641-166114663 AACAGATAGTGGGAGTAGGGAGG + Intronic
917253255 1:173086215-173086237 CACTGTTGGCAGGAGAATGGAGG + Intergenic
918627266 1:186670501-186670523 AAGTGAAGGAAAGAGTATGGTGG + Intergenic
924617458 1:245624402-245624424 AAATGCTGGTGGGGGTATGGAGG - Intronic
1064214506 10:13388285-13388307 AAATGATGGTAGTAGTATTTTGG + Intergenic
1065477974 10:26161492-26161514 TACTGAAGGCAGTAGTATGGTGG + Intronic
1067296311 10:44976989-44977011 AACTGGTGGTAGGGGTGTGAGGG - Exonic
1069764289 10:70841626-70841648 AGCTGATGGTAGGAGGAAGAGGG - Intronic
1077233060 11:1467123-1467145 AACAGGTGGTAGAAGGATGGAGG - Intergenic
1078808288 11:14730145-14730167 AACTGATGGTAGCAACATCGAGG - Intronic
1080051629 11:27864473-27864495 TACTGATGGTAGGAGCTGGGAGG - Intergenic
1081076786 11:38685017-38685039 AACAGATTGTAGGAGTAAGGTGG - Intergenic
1081133293 11:39406829-39406851 AATTTATGGTAGGGGTATGGTGG + Intergenic
1083463435 11:62830658-62830680 AACTTATGGTAGAAGTATATTGG + Intronic
1088842929 11:113641871-113641893 GACTGATGGCAGGTGTAAGGTGG - Intergenic
1092893088 12:12987510-12987532 CGCTGTTGGTAGGAGTATAGTGG + Intronic
1094450563 12:30579109-30579131 AAATGATGGCAAGAATATGGAGG + Intergenic
1094673396 12:32593994-32594016 ATCTGGTGGTAGGAGCATAGAGG + Intronic
1095132316 12:38558839-38558861 AAATGATGGTAGCAGTTTGTAGG - Intergenic
1096309707 12:50509873-50509895 ATCTGATGCTAGGAGTATTAAGG + Intronic
1097343594 12:58467005-58467027 AACTGCTTGTAGGGGTCTGGAGG + Intergenic
1100756398 12:97755895-97755917 AACTGATGTTAGGAGAATGATGG + Intergenic
1105795124 13:23843996-23844018 CAATGATGGGAGGAGGATGGAGG + Intronic
1108088429 13:46819605-46819627 GAGTGAAGGAAGGAGTATGGAGG + Intergenic
1108153502 13:47561253-47561275 AGCTGCTGGTCTGAGTATGGAGG - Intergenic
1109142025 13:58725306-58725328 AGCTGGTGGCAGGAGTGTGGAGG + Intergenic
1110399944 13:75078496-75078518 CACAGATGGTAGAAGTATGAGGG - Intergenic
1111401304 13:87739176-87739198 AACTCAAGGTAAGAGTATGAAGG + Intergenic
1112206719 13:97331387-97331409 ATCCGTTGGTAGGAGGATGGAGG - Intronic
1112714971 13:102173811-102173833 AGCTGAGGGTAGGGGTAGGGGGG + Intronic
1115328869 14:32171928-32171950 ATCTGAGGGTAGGAGTGAGGTGG - Intergenic
1117615512 14:57530049-57530071 AATTGGTGGTAGGAGAAGGGTGG + Intergenic
1118657728 14:67970227-67970249 AATTAATGGTAGCAGTAGGGTGG + Intronic
1121910305 14:97784364-97784386 ATCTGATGGGATGAGCATGGTGG - Intergenic
1122737654 14:103852715-103852737 CACTGATGTTATGAGTTTGGGGG + Intergenic
1124784107 15:32663306-32663328 GACTGAGGGAAGGAGTAAGGAGG - Intronic
1127570274 15:60234878-60234900 AGCTGATGGTGGGGGTAGGGAGG - Intergenic
1128682452 15:69661837-69661859 AACTGATGATAGGATGAGGGTGG + Intergenic
1128741145 15:70084511-70084533 AACTGATGCCTGTAGTATGGTGG + Intronic
1128973754 15:72132813-72132835 AAATGATAGTAGGAATGTGGAGG - Intronic
1135573503 16:23567268-23567290 AACTGATGGAAGGTGTGTGTGGG - Intronic
1137043277 16:35633680-35633702 AAATGTTGGCAAGAGTATGGAGG - Intergenic
1139033483 16:62914280-62914302 AATTGATTGTAAGAATATGGGGG - Intergenic
1139631421 16:68234164-68234186 AAGTGAGGGTAGGAGGAAGGAGG + Intronic
1140041894 16:71413599-71413621 AAATGGTGGCAGGAGTTTGGTGG + Intergenic
1142357989 16:89612940-89612962 AACAGATGGTGAGAATATGGAGG + Intergenic
1146241020 17:31226195-31226217 AACAGATGGTAGCATTATGTTGG + Intronic
1147745979 17:42694861-42694883 TACTGGTGGGAGGAGTGTGGGGG + Intronic
1154157900 18:11958452-11958474 AACTGATATCAGGAGTAGGGCGG + Intergenic
1157456453 18:47834033-47834055 AGCTGAAGGTACCAGTATGGTGG - Exonic
1157952888 18:52060108-52060130 AACTGAGGGCTGGAGTATAGAGG - Intergenic
1159174293 18:64813943-64813965 CACTGTTGGCAGGAGTAGGGCGG - Intergenic
1160001754 18:75031069-75031091 AACTGCTGCTATGTGTATGGGGG - Intronic
1160244302 18:77144889-77144911 ACCTGATGGGAGGTGCATGGGGG + Intergenic
1160330244 18:77984488-77984510 CATTTATTGTAGGAGTATGGCGG - Intergenic
1163398273 19:17076473-17076495 AACTGAGGGTAGGCTTAGGGAGG + Intronic
1165565622 19:36724879-36724901 AAGTGATGGAAAGAATATGGAGG - Intronic
924997571 2:377017-377039 AAGTGATGTTAGCAATATGGTGG + Intergenic
926787697 2:16534562-16534584 AACTGATTGAAGTAGTGTGGTGG - Intergenic
927668504 2:25049107-25049129 AACTGCTAGTAGGAGTATAATGG - Intronic
930092842 2:47543904-47543926 CACTGATGGGAGGAGGATTGAGG + Intronic
935043256 2:99454761-99454783 AACTAATAGTAGGAGTATTGTGG - Intronic
936952405 2:117991400-117991422 AACTGGTGCTAGGAATATGTGGG + Intronic
939410024 2:141813305-141813327 GACTGACGGTTAGAGTATGGAGG + Intronic
947877279 2:233476111-233476133 GACTGTTGGGAGGAGTATGAGGG + Exonic
1170357140 20:15505413-15505435 AATTGATGGTAGGAGGAGAGGGG - Intronic
1170954254 20:20964006-20964028 AAGTGAAGGTAGAAGAATGGGGG + Intergenic
1172295839 20:33810658-33810680 AACAGATGGTAGAGGTATGTTGG + Intergenic
1173990965 20:47303147-47303169 AATTTATTGTAGGGGTATGGGGG + Intronic
1177781754 21:25629550-25629572 AAGTGATGGTAGTAGGATGTGGG - Intergenic
1180919472 22:19513481-19513503 AACAGCTGGAAGGAGTTTGGAGG - Intronic
1184942728 22:47780954-47780976 AATGGATGGTTGGAGGATGGAGG + Intergenic
950007057 3:9698203-9698225 TAGTGAAGGTAGGTGTATGGTGG + Intronic
950706573 3:14786068-14786090 ACCTGCTGGCAGGAGTCTGGGGG - Intergenic
951502538 3:23405597-23405619 AAGTGAGGGGAGGAGTATAGAGG + Intronic
954656774 3:52198631-52198653 AAATGAGGGTAGGGGTATGAGGG - Intronic
955547054 3:60042299-60042321 TATCGATGGTAGGACTATGGAGG - Intronic
956751030 3:72344070-72344092 AAATGTGGGTAGGTGTATGGGGG - Intergenic
960148985 3:114232179-114232201 AACTGTTGGTAGCAGTAGGGTGG + Intergenic
964918531 3:161866895-161866917 AACTGATGTTACGAATCTGGTGG + Intergenic
967674667 3:192282456-192282478 ATCTCATAGTGGGAGTATGGAGG - Intronic
971861033 4:32106218-32106240 AACTGAAGGTAGAATTTTGGGGG - Intergenic
973603614 4:52565443-52565465 CACTGATGGTGGGAGTGGGGTGG + Intergenic
979601191 4:122587979-122588001 CACTGATGGGAGGAATAAGGTGG + Intergenic
980523280 4:133958513-133958535 AACTGATGCCAGGAGTAGTGGGG - Intergenic
981926646 4:150147718-150147740 AACTGATGCTGGAAGTATGCAGG + Intronic
982605894 4:157515552-157515574 TACAGCTGGCAGGAGTATGGAGG + Intergenic
983280747 4:165678073-165678095 AACTGATGGGAGGAGTGCTGAGG + Intergenic
984320794 4:178193201-178193223 AGTTGATGGTTGGAGTACGGTGG + Intergenic
984691251 4:182728373-182728395 ATCTATTGGTAGGAGTATGAAGG - Intronic
991099443 5:62776469-62776491 GACTGCTGGTAGTAATATGGTGG - Intergenic
991280133 5:64904089-64904111 AACTGTTTGTAGAAGCATGGTGG - Intronic
991948335 5:71923361-71923383 AAGTGTTGGAAGGAGTATGAAGG + Intergenic
994554456 5:101280392-101280414 AAGTGATGGTAGGTGTTTTGAGG - Intergenic
995140095 5:108726652-108726674 ATCTGATGGTAACAGGATGGAGG - Intergenic
998962991 5:147509032-147509054 AAGTGATGCTGGGAATATGGGGG - Intronic
999705196 5:154266364-154266386 ATTGGATGGTAGGATTATGGAGG + Intronic
1001848336 5:174941036-174941058 AAGTGATGGGAGGAGTCTGGAGG + Intergenic
1002064595 5:176645773-176645795 GAATGAGGGTAGGAGTCTGGTGG + Intronic
1002180649 5:177429399-177429421 AACTGAGGGTGGGAGGCTGGCGG + Intronic
1006781990 6:36638151-36638173 CAGTGATGGTAGGAGATTGGAGG - Intergenic
1008876349 6:56333756-56333778 AAGTGATGGCAAGGGTATGGAGG - Intronic
1011972132 6:93238812-93238834 AACAGCTGGTAGGAGTGTGTGGG + Intergenic
1012029832 6:94044882-94044904 GACTGAGGGTAGGGGAATGGAGG + Intergenic
1013893161 6:115050780-115050802 AACGGATGGTTGGAGTATGGAGG + Intergenic
1017343569 6:153354477-153354499 AACTAGTGGTAGGAGGATTGTGG + Intergenic
1017590785 6:155976173-155976195 AACTAATGGAATGAGTTTGGGGG - Intergenic
1024945612 7:54804877-54804899 CACTGATGGTGTGAGTATGTAGG + Intergenic
1025926359 7:65963421-65963443 AACTGAAGATAGCAGTTTGGTGG - Intronic
1032496061 7:132363759-132363781 AACAGATGGTGGCAGTATGATGG - Intronic
1032558893 7:132867009-132867031 AAATGATGGTATGTGTATGGTGG - Intronic
1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG + Intronic
1035660814 8:1346692-1346714 AACTCATGGTAGCTGTGTGGAGG + Intergenic
1035660821 8:1346790-1346812 AACTCATGGTAGATGTGTGGAGG + Intergenic
1035858189 8:2999605-2999627 AGCTGATAGTAGGAGGGTGGAGG - Intronic
1037377759 8:18250498-18250520 AACTGATGGCAGCACAATGGTGG + Intergenic
1037884279 8:22588249-22588271 AACTGCTGGTAGCAGCCTGGTGG + Intronic
1040682221 8:49825991-49826013 GACTGATGGTAGGAATAAGCTGG - Intergenic
1045340007 8:101245204-101245226 AACTGATGGTGAGAGTAAGATGG - Intergenic
1052518012 9:29508938-29508960 AACTGGGGGTGGTAGTATGGGGG + Intergenic
1053072026 9:35107443-35107465 AACTGTTGGCAGCAGTAGGGTGG + Exonic
1056405053 9:86265637-86265659 GACTGCTGGTAGTAATATGGTGG - Exonic
1056522280 9:87412118-87412140 AACTGAGGGAAGGGGTTTGGGGG - Intergenic
1057672739 9:97108886-97108908 ACATGATGGTAGGTGTATAGTGG - Intergenic
1057688517 9:97261027-97261049 AAGTGATGGTATGTGTATGTGGG - Intergenic
1061062348 9:128256992-128257014 AAGGGATGGTAGGGATATGGTGG + Exonic
1187084977 X:16032934-16032956 AGCTAATGGTGGGAGTTTGGTGG + Intergenic
1187643113 X:21316456-21316478 AAATGATGGTAGAAAGATGGTGG + Intergenic
1188970811 X:36613259-36613281 TACTGCAGGTAGGATTATGGAGG - Intergenic
1188979546 X:36714716-36714738 AACTTATGGTAGGAATCAGGAGG + Intergenic
1199783655 X:151084707-151084729 AGCTCATGGTGGGAGTATGAAGG + Intergenic
1200314146 X:155113972-155113994 AAGTGTTGGTGGGAATATGGAGG + Intronic
1202016290 Y:20410221-20410243 AGCTGATGATAGGACTATTGAGG + Intergenic