ID: 1034089877

View in Genome Browser
Species Human (GRCh38)
Location 7:148353886-148353908
Sequence AGACACCAAAAACTTATTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 354}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034089877_1034089881 26 Left 1034089877 7:148353886-148353908 CCATTAATAAGTTTTTGGTGTCT 0: 1
1: 0
2: 1
3: 27
4: 354
Right 1034089881 7:148353935-148353957 TCATTTGAGTACACTCAGAATGG 0: 1
1: 0
2: 1
3: 9
4: 170
1034089877_1034089879 -1 Left 1034089877 7:148353886-148353908 CCATTAATAAGTTTTTGGTGTCT 0: 1
1: 0
2: 1
3: 27
4: 354
Right 1034089879 7:148353908-148353930 TGCTTCTGGTTTTATTACCGAGG 0: 1
1: 0
2: 0
3: 8
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034089877 Original CRISPR AGACACCAAAAACTTATTAA TGG (reversed) Intronic
900019547 1:179492-179514 AAACTCCAAATACTTATGAATGG - Intergenic
902065970 1:13687926-13687948 AAACACCAAAAAGTTCTCAAAGG + Intergenic
904917859 1:33983263-33983285 AGATGCCAAGAACTTATTTATGG + Intronic
905411663 1:37774150-37774172 CCACACTAAAAACATATTAAAGG + Intergenic
906365112 1:45202854-45202876 AGACACCTATAATTTACTAACGG - Intronic
907164941 1:52402176-52402198 AGACCAGAAAAACTTATTCATGG - Exonic
908423519 1:63982539-63982561 AGAAAACAAAACCTTACTAATGG - Intronic
908580820 1:65514556-65514578 ATACACCAAAATGTTATCAAAGG - Intronic
909290571 1:73878148-73878170 AGGGACCAAAAACTAATGAAAGG + Intergenic
909705492 1:78578478-78578500 AGACATCAAAATCATATAAAAGG - Intergenic
911820904 1:102419807-102419829 AGACAGCAAAAGCAAATTAATGG + Intergenic
913593772 1:120353997-120354019 ATACTCCACAGACTTATTAATGG - Intergenic
914093483 1:144524989-144525011 ATACTCCACAGACTTATTAATGG + Intergenic
914295014 1:146312874-146312896 AGACACCAAGACCTACTTAACGG - Intergenic
914305045 1:146408913-146408935 ATACTCCACAGACTTATTAATGG - Intergenic
914330793 1:146669220-146669242 ACACACCAAAAATTTAATAGTGG - Intergenic
914514629 1:148363502-148363524 ATACTCCACAGACTTATTAATGG + Intergenic
914556055 1:148763657-148763679 AGACACCAAGACCTACTTAACGG - Intergenic
914597013 1:149163909-149163931 ATACTCCACAGACTTATTAATGG + Intergenic
916813012 1:168322142-168322164 ACACACCTAAAACTCAATAATGG + Intergenic
917001335 1:170364073-170364095 AGACACCACATAAATATTAAAGG - Intergenic
917094837 1:171389714-171389736 AAACACAAAAAACTGAGTAAAGG - Intergenic
917970747 1:180205587-180205609 AGACACCAAAACATTAATAGTGG + Intergenic
918494848 1:185123368-185123390 AGACACTAAATTCATATTAAAGG - Intronic
918697458 1:187561170-187561192 AGACTTAAAAAACTTATGAAGGG + Intergenic
918808744 1:189086829-189086851 AGACACCAAAAATTTAGTTTGGG - Intergenic
918811130 1:189122606-189122628 AGTGACCAAAGATTTATTAATGG - Intergenic
919567303 1:199204716-199204738 AGGAACCAAAAAGTTATAAAGGG - Intergenic
919574869 1:199295161-199295183 AGACACCAAAGACTTTTGAGCGG - Intergenic
920943567 1:210506873-210506895 ACAGACCAAAAACTTCATAAGGG - Intronic
920967488 1:210713092-210713114 AGAGAAGAAAAACTTTTTAAAGG - Intronic
921996428 1:221424913-221424935 ACACTACAAAAACTTATTCATGG - Intergenic
1063562637 10:7143691-7143713 AGACCCCAGAAACTTAATCAGGG - Intergenic
1064788144 10:18922289-18922311 AAAAACAAAAAACTTATTAAGGG - Intergenic
1065725094 10:28661491-28661513 AGGGACCAAAAACTAATGAAAGG - Intergenic
1067516773 10:46954557-46954579 AGACATCAAAAAGTTAATGAGGG - Intronic
1067645478 10:48097269-48097291 AGACATCAAAAAGTTAATGAGGG + Intergenic
1071560484 10:86643021-86643043 AGTGACCAAAAATTCATTAAAGG - Intergenic
1072807835 10:98435813-98435835 AGACACCAAGAACTAAGGAAGGG + Intronic
1073539912 10:104309790-104309812 ATACACCAAAAACTTCATATTGG + Exonic
1073960203 10:108917957-108917979 TGACACAAAATACTTATCAAAGG - Intergenic
1075639335 10:124053460-124053482 AGACACCAGAGACATAATAAAGG + Intronic
1077290998 11:1793029-1793051 ACACACAAAAAAATTCTTAAAGG - Intergenic
1077855363 11:6118867-6118889 AGACACAAAAAAATGATAAAGGG + Intergenic
1078404679 11:11059989-11060011 AGAGGCCAAAAACTAAGTAAAGG - Intergenic
1078685900 11:13531526-13531548 AGACACAAAAAAATAATAAAAGG - Intergenic
1078806044 11:14705429-14705451 AGAAATCAAAAACTAATTTATGG + Intronic
1079214869 11:18500014-18500036 AGACACCAGAGACTTAAGAACGG - Intronic
1079552857 11:21722290-21722312 ATAAACCCAAAACTTATTAGAGG + Intergenic
1079583059 11:22090146-22090168 AGACATCAAAAACTAACTATAGG - Intergenic
1079593135 11:22205801-22205823 AGATACCAAAAAGATAATAAAGG + Intronic
1080281504 11:30562646-30562668 AGGCACCTACAGCTTATTAAGGG + Intronic
1080430457 11:32193811-32193833 ATACACCAAAAAATTAATAGTGG - Intergenic
1082271452 11:50173999-50174021 ACATAATAAAAACTTATTAATGG - Intergenic
1082714472 11:56594818-56594840 ACACACAAAACATTTATTAATGG + Intergenic
1082924917 11:58534812-58534834 AGACACAAAAAAATGATAAAGGG + Intronic
1084536131 11:69758332-69758354 AGACAACAACAACTTATCCAAGG - Intergenic
1085914680 11:80871485-80871507 ACACAGCAAGAACTTAATAAAGG - Intergenic
1085938365 11:81178154-81178176 AGTTACCTAAAACTTGTTAATGG - Intergenic
1086057780 11:82667513-82667535 AAACAGCAAAAATATATTAATGG + Intergenic
1086582580 11:88416037-88416059 GGAGACCAAAAAATAATTAAAGG - Intergenic
1086960725 11:92977952-92977974 AGAGACCATAAACTTTATAAGGG + Intronic
1087085358 11:94212845-94212867 AGACACCAGAAAGATGTTAAGGG - Intergenic
1087445124 11:98241325-98241347 AGACATCAAAAACTTAATAAAGG - Intergenic
1087507258 11:99041533-99041555 AGACACCACATGCTTATTGAAGG + Intronic
1088757836 11:112901314-112901336 AGACAGCAAAGACTCATCAAGGG + Intergenic
1088792137 11:113235426-113235448 AGGCACCAACACATTATTAAAGG + Intronic
1088802823 11:113322069-113322091 AGATACCATCAACTTATAAATGG + Intronic
1090456439 11:126854111-126854133 ACACACAAGAAACTTATTACTGG - Intronic
1092593993 12:9980112-9980134 AGACAATAAAAACTAATTACTGG - Intronic
1092734039 12:11562643-11562665 AAACACCAAAATATTAATAATGG + Intergenic
1093142600 12:15527049-15527071 ACACACCAAAAGTTTATAAATGG + Intronic
1093322425 12:17729407-17729429 GGACATGAAAAACTTATTAGAGG + Intergenic
1093665551 12:21808600-21808622 AGACATCAAAAAACTATTATGGG + Intronic
1094200471 12:27790073-27790095 ACACACAAAAAACTTATATAAGG - Intronic
1094401358 12:30063833-30063855 ACAAACCAAAACCTAATTAAGGG - Intergenic
1098889415 12:75993735-75993757 AGACACTAAAATCATATAAAGGG + Intergenic
1099916392 12:88899753-88899775 AGAGACAAAAAACATATTACTGG + Intergenic
1100541931 12:95565418-95565440 AGACAAAGAAAACCTATTAATGG + Intergenic
1100776646 12:97982300-97982322 AGACACCAAGAACTTATACTGGG + Intergenic
1101049702 12:100848569-100848591 AGACACCAAAGACTCACAAAGGG - Intronic
1102820358 12:115903916-115903938 AGGCACTAAAAACTGATTGAAGG + Intergenic
1103018476 12:117514507-117514529 AGAAACCAAAGACATCTTAAAGG - Intronic
1103184477 12:118944486-118944508 AGACACACAAAACCAATTAAGGG - Intergenic
1104340876 12:127947269-127947291 AGGGACCAAAAACTAATGAAAGG + Intergenic
1105691101 13:22840006-22840028 AAACACAAAAAACTCATTATCGG + Intergenic
1106460986 13:29968519-29968541 AGATATCAAAAAGGTATTAATGG + Intergenic
1106749853 13:32751040-32751062 AGACACCAAAGCCTTCTTGAGGG - Intronic
1106785050 13:33099024-33099046 ATATACCAATAAATTATTAAAGG - Intergenic
1107953004 13:45482777-45482799 AGACACCAACAATTTAAAAACGG - Intronic
1108024824 13:46166956-46166978 AGAAACCAAATAATTATAAATGG + Intronic
1108124561 13:47227353-47227375 AGAAACAAAAAACTTAACAACGG - Intergenic
1109015287 13:57002893-57002915 AGAAACCAAAAACAAATAAATGG + Intergenic
1109472242 13:62823974-62823996 AGACACTATAAAATTATTAGAGG - Intergenic
1109699906 13:66010988-66011010 AGACTCCTAAAACTTATTTAAGG - Intergenic
1110913698 13:80995773-80995795 AAACACGAAAAACCTATAAAAGG - Intergenic
1111208591 13:85046533-85046555 AGAATCCAACAACATATTAAAGG + Intergenic
1114920227 14:27317012-27317034 AGACACTAATAACATTTTAAAGG + Intergenic
1115449080 14:33525709-33525731 GGACACATAAAACCTATTAATGG + Intronic
1116083729 14:40207817-40207839 AGACACCAGAAATTTAAAAATGG - Intergenic
1117023087 14:51592062-51592084 ATACACCAAAAAGTTAATATAGG + Intronic
1118179251 14:63474763-63474785 GGACACCAACAACATATAAATGG + Intronic
1119886117 14:78144308-78144330 AGTGACCAAAAAGTTAGTAAAGG + Intergenic
1120078251 14:80185301-80185323 AGACATCAAAAATTTATCGAGGG - Intergenic
1121379653 14:93452199-93452221 AGACAGTAAATACTTTTTAAAGG - Intronic
1122618651 14:103039774-103039796 AGACAACAAAAAGAAATTAAAGG + Intronic
1125182309 15:36891398-36891420 ACACAAAAAAAAGTTATTAATGG - Exonic
1126267931 15:46776567-46776589 AGACATCACATACTTATTCAAGG + Intergenic
1127194008 15:56564696-56564718 ATACAATAAAAAATTATTAAGGG + Intergenic
1127556525 15:60093260-60093282 AGGTAGCATAAACTTATTAAAGG + Intergenic
1127896330 15:63302640-63302662 ACACACCAAAAAATTAATAGTGG - Intronic
1128173483 15:65532694-65532716 AGAAAACAAAAACTCAATAAGGG - Intronic
1128237047 15:66075224-66075246 AGTCACCAAACATTTATTAGGGG - Intronic
1129534957 15:76305788-76305810 AGTCACCAAAAACTTCATTATGG + Intronic
1130548868 15:84876622-84876644 ACACAGCAAAAATGTATTAATGG + Intergenic
1131712147 15:95067647-95067669 TGAGAGCAAAAACTTGTTAAGGG + Intergenic
1134214404 16:12305717-12305739 AGACTCCGAAAACTTCTGAATGG + Intronic
1134750870 16:16623978-16624000 ATACACAACAAATTTATTAATGG - Intergenic
1134994584 16:18729613-18729635 ATACACAACAAATTTATTAATGG + Intergenic
1136665297 16:31806008-31806030 AGATACAAACTACTTATTAATGG + Intergenic
1137949176 16:52766350-52766372 AGACACTGAAAAGTTATCAAAGG + Intergenic
1138559705 16:57793887-57793909 AAACACCAAATACTTAATAGTGG + Intronic
1138682517 16:58696127-58696149 AGCCACTCAAAACTTTTTAAAGG + Intergenic
1138727442 16:59155514-59155536 AAACACCCAAAACTAATTAGTGG + Intergenic
1138780581 16:59780201-59780223 AGACAAGAAAAATTTATGAAGGG - Intergenic
1138890770 16:61141920-61141942 ATTCACCAAAAAACTATTAAAGG - Intergenic
1142444109 16:90122981-90123003 AAACTCCAAATACTTATGAATGG + Intergenic
1144058351 17:11560365-11560387 AGACACATAAACCTTCTTAAGGG + Exonic
1144362915 17:14512422-14512444 AGACATTAAAAACTATTTAAAGG - Intergenic
1145057986 17:19715566-19715588 ATACACCAAAATCTTAGTAATGG + Intronic
1145731019 17:27185878-27185900 AGACACAAAAAAATGATAAAGGG - Intergenic
1145965916 17:28917162-28917184 AGACACCACAAACCTATTTCTGG + Intronic
1146130638 17:30271360-30271382 AGACACCAAACACTAACTCATGG + Exonic
1146465542 17:33083553-33083575 AGACAGCAAAGTCTTCTTAAAGG + Intronic
1148210410 17:45805195-45805217 AAATATCAAAAACTTTTTAAAGG - Intronic
1149125538 17:53226085-53226107 ACACACCAGAAACATCTTAATGG - Intergenic
1149132521 17:53322003-53322025 AGACAACAAAATATTATTCAGGG + Intergenic
1150101459 17:62427357-62427379 AGACAGCAACTATTTATTAAGGG - Intronic
1150618501 17:66790549-66790571 AGACAACAAATAAATATTAAAGG - Intronic
1150937163 17:69649093-69649115 ATAAACCAATAATTTATTAATGG - Intergenic
1152511677 17:80793971-80793993 TGACACCAAAATCTTGTTCAAGG - Intronic
1153423541 18:4936919-4936941 AGACACTAAAGACCTATAAAAGG + Intergenic
1153929130 18:9863281-9863303 AGACAACAAAAACTATATAAAGG + Intergenic
1155068699 18:22293263-22293285 AGACATCTTAAACTTTTTAATGG + Intergenic
1155515366 18:26619415-26619437 ATACACCAAAATGTTATTAGTGG - Intronic
1156949322 18:42874661-42874683 TGAGACCAGAACCTTATTAAAGG - Intronic
1158299903 18:56040089-56040111 AGACTCCAAAAACTTAATTATGG + Intergenic
1159204290 18:65230569-65230591 TGACACCAAAAAACTATTAAAGG + Intergenic
1159500418 18:69261814-69261836 AAATACCAAAAATTTTTTAAAGG + Intergenic
1160653113 19:244936-244958 AAACTCCAAATACTTATGAATGG - Intergenic
1165677897 19:37744156-37744178 ATACACCAAAAAGGTATGAAAGG + Intronic
1166441608 19:42820392-42820414 AGGCACCTCAAACTTATTTAAGG + Intronic
1166449745 19:42888382-42888404 AGGCACCTGAAACTTATTTAAGG + Intronic
1166461045 19:42988680-42988702 AGGCACCTGAAACTTATTTAAGG + Intronic
1166922882 19:46242983-46243005 AGACACTAAAAGATTAATAATGG - Intergenic
1167932991 19:52883408-52883430 ACATACCAAAAACTCATAAAAGG + Intronic
1168726738 19:58587281-58587303 AAACTCCAAATACTTATGAATGG + Intergenic
924958919 2:16214-16236 AAACTCCAAATACTTATGAATGG - Intergenic
925315918 2:2922998-2923020 AAATAATAAAAACTTATTAAAGG + Intergenic
925526467 2:4808477-4808499 AAACAATAAAAAATTATTAATGG - Intergenic
925682323 2:6435492-6435514 AAACACCAAATACTTATCAATGG - Intergenic
927010144 2:18895612-18895634 AGTTAACAAAAACTTATCAATGG + Intergenic
927523585 2:23718105-23718127 AGACAGAAAACAATTATTAATGG + Intergenic
928673468 2:33626452-33626474 AGACTCTAAACACTTATTGAAGG + Intergenic
931129744 2:59321924-59321946 ATACACAAAACACTTCTTAAAGG + Intergenic
931243877 2:60476885-60476907 ACACACAAAAATCTCATTAATGG - Intronic
931385682 2:61795632-61795654 TGACCCCATAAACTTATTAGAGG - Intergenic
933465938 2:82651758-82651780 AGCAAAGAAAAACTTATTAAGGG - Intergenic
936466143 2:112752885-112752907 ACACACCAAGACCTTATTGAGGG - Intronic
936571817 2:113623925-113623947 AAACTCCAAATACTTATGAATGG - Intergenic
936603790 2:113926940-113926962 ATACAACAAATACTTGTTAATGG + Intronic
936994719 2:118401169-118401191 AGACAACAGAAAGATATTAAGGG - Intergenic
937766737 2:125669934-125669956 AGACAAAAAAAATTTATTATGGG - Intergenic
937891726 2:126944249-126944271 AGACCCCAGCAACTTATAAATGG - Intergenic
938375544 2:130803412-130803434 AGACACTAAACACTTAATCATGG + Intergenic
938391723 2:130912005-130912027 AGACACCAAGAACTGATCTAAGG - Intronic
938974687 2:136464765-136464787 AAATATCAAAAACTTAATAAAGG - Intergenic
941289820 2:163661595-163661617 ACACACCCAAACCTTATCAATGG - Intronic
941291882 2:163685922-163685944 AGACAACAATAAATTTTTAAAGG + Intronic
941328775 2:164150189-164150211 AGACACCATTAACCTATTAGAGG - Intergenic
941378278 2:164758207-164758229 AGATACCAATAACTTAAAAATGG + Intronic
941616748 2:167729201-167729223 GGACACCTAAAAATCATTAAGGG + Intergenic
942232064 2:173869670-173869692 TGACTCCAAAAAGTTATAAAGGG - Intergenic
943708589 2:191062690-191062712 AAACACCAAAACCTTAGGAAGGG + Intronic
943973814 2:194445779-194445801 AAACACCAAAAATCTATTAAAGG - Intergenic
945868116 2:215199381-215199403 ATGCACCAAAAATATATTAAAGG - Intergenic
946655045 2:221937320-221937342 AGACACCAAAAAAAGAATAAAGG - Intergenic
947947500 2:234119011-234119033 GGAAAACAAAAACTTATTACTGG + Intergenic
948843055 2:240667253-240667275 TGAAACCAAAAGCTTTTTAAAGG - Intergenic
1168742221 20:201479-201501 AGACTCCCAAAAATTATTTATGG - Intergenic
1170080279 20:12467478-12467500 ACACTCCAAGCACTTATTAAAGG + Intergenic
1171843034 20:30238904-30238926 ATACACAAAGAACTTATTATAGG + Intergenic
1175350047 20:58310973-58310995 AGACACCAAAAACTACTTTGTGG - Intronic
1177019329 21:15834016-15834038 AAACATCAAATAGTTATTAATGG - Intronic
1177643506 21:23873508-23873530 AGAGACCAAAATATTAATAATGG + Intergenic
1177676116 21:24301546-24301568 GGAAACCAAAATGTTATTAATGG - Intergenic
1177990672 21:28031865-28031887 AGACATTAAAAGCATATTAAAGG - Intergenic
1178318864 21:31589680-31589702 AAAAACCAAAAACTGATTTATGG + Intergenic
1180572477 22:16740646-16740668 AGGCACCAAATTCTGATTAAAGG + Intergenic
1183048643 22:35242458-35242480 AGACACCAAAAGAATAATAAGGG - Intergenic
1185428378 22:50786964-50786986 AAACTCCAAATACTTATGAATGG + Intergenic
949789059 3:7772800-7772822 AGACAGCAAAGATTTATAAAGGG + Intergenic
950999890 3:17545645-17545667 AAACACCAAAATCTTATTAGTGG - Intronic
952568465 3:34684894-34684916 AGTAACCAGAATCTTATTAAAGG + Intergenic
954944946 3:54415010-54415032 AGACGTCAAAAACTTTGTAAAGG + Intronic
955087512 3:55717568-55717590 AGAAACCACATACTTATTCAGGG - Intronic
957941786 3:87015332-87015354 ATACACTAAAAAATTATTCATGG - Intergenic
959096240 3:101959169-101959191 GGACACCAAATTCTTATAAAAGG + Intergenic
959790707 3:110357847-110357869 GGACACCAAAAAAATGTTAAAGG + Intergenic
959867186 3:111284112-111284134 ACAAACCAAAAAACTATTAAGGG + Intergenic
960291834 3:115895327-115895349 AGAGACCAAACATTCATTAAAGG + Intronic
961742846 3:129044962-129044984 AGACATCAAAAGGATATTAAAGG + Intergenic
963221196 3:142814066-142814088 AAACACCATAAACTTTTAAAAGG - Intergenic
963834586 3:150044625-150044647 AGACACCAAAAGGATAATAAGGG + Intronic
964175345 3:153821055-153821077 AAACAGGAAAAAATTATTAAAGG - Intergenic
964784714 3:160383342-160383364 AGACAGTAAAAACTATTTAAGGG + Intronic
964926655 3:161966571-161966593 AGTCACTAAACAATTATTAAAGG + Intergenic
966707525 3:182932847-182932869 AGACAATAAAAAATAATTAAAGG + Intergenic
970401299 4:15720172-15720194 AGACAGATAAAACTAATTAATGG - Intronic
970833759 4:20374824-20374846 TGACAATATAAACTTATTAAAGG + Intronic
971672343 4:29578821-29578843 AGACACCACAGATTTTTTAAAGG - Intergenic
971751816 4:30659956-30659978 AGACCACAAAAATTTATTTAAGG + Intergenic
973627439 4:52787152-52787174 GGACACCAAAATATTAATAATGG + Intergenic
975125099 4:70773054-70773076 AGACACCAAAATATTAGCAATGG + Intronic
975152967 4:71041160-71041182 AGACATTAAAAAGTTAATAAAGG - Intergenic
975836833 4:78431899-78431921 ATAAAGCAAAAACTTCTTAAAGG + Intronic
976472007 4:85439904-85439926 AGACACCAAAAACCCATCTAGGG + Intergenic
976490826 4:85667930-85667952 TGACACCTAAAAATTATTTATGG + Intronic
977283149 4:95067766-95067788 AGACACTAAACATTTAATAAAGG - Intronic
977466367 4:97386917-97386939 TGACACAAAAAAATTATAAATGG + Intronic
977628985 4:99220728-99220750 AGACATCAAAAAGATAATAAGGG - Intergenic
977869069 4:102068505-102068527 AGACATTAAAAACATACTAAGGG + Intronic
977904737 4:102463249-102463271 AAATACCAAATACTTATTACTGG - Intergenic
979811807 4:125045637-125045659 GGAAACCAAAAACTTATGTAGGG + Intergenic
980522866 4:133954444-133954466 AAAGACCAAAGACTTATGAATGG + Intergenic
980605836 4:135087616-135087638 AGACTCCAAAAAATTATTGCAGG + Intergenic
981037233 4:140184614-140184636 AGACACTAACACATTATTAAAGG - Intergenic
981651387 4:147063164-147063186 AGACACCAAAAAATTGATAAGGG - Intergenic
981807548 4:148734156-148734178 ATAAACCAAAGACTTCTTAAGGG + Intergenic
982364765 4:154565338-154565360 AGACATTAAAGACTTATTAAAGG - Intronic
982617694 4:157661820-157661842 AAACCCTAAAAACTTATTAATGG + Intergenic
982900949 4:161002738-161002760 AGACACCAAAAACCTAAAGAGGG + Intergenic
983109403 4:163729661-163729683 AGACATCAAAAAGTTAATAAAGG - Intronic
983521176 4:168710539-168710561 ACACAACCAAAACTTATTTAGGG + Intronic
984506623 4:180627499-180627521 AGGATCCAAAAACTTATTTAGGG + Intergenic
985186356 4:187320534-187320556 AGACAGAAAAAACATATCAAAGG + Intergenic
985464795 4:190183737-190183759 AAACTCCAAATACTTATGAATGG + Intronic
986946134 5:13023485-13023507 AGACAACAAAATGTTTTTAAAGG + Intergenic
987900569 5:24005793-24005815 ATAGAGTAAAAACTTATTAAAGG - Intronic
987986109 5:25148356-25148378 AGACACCAAGAACATATAATAGG + Intergenic
988473552 5:31563498-31563520 AGGGACCAAAAACTAATGAAAGG + Intergenic
989967310 5:50479696-50479718 AAACAACAAAAACATATTTAAGG + Intergenic
991014785 5:61919284-61919306 AGACACCAAGAAATCATTACTGG + Intergenic
991117052 5:62966217-62966239 AGAAAACAAAAACTCAATAAGGG - Intergenic
993083609 5:83334571-83334593 ATTCACCAACAAATTATTAAGGG + Intronic
994222719 5:97215012-97215034 AGACACAAAAAAAGTGTTAAAGG + Intergenic
994825859 5:104712294-104712316 AGACATGAAAAATTTATTGAAGG - Intergenic
994901880 5:105783393-105783415 AGAGAACTAAGACTTATTAATGG + Intergenic
995478221 5:112569290-112569312 AGACATCAAAGACTTATTTGGGG - Intergenic
996998593 5:129729696-129729718 AGACCCCAAAATTTTATAAAAGG + Intronic
1000499171 5:162026961-162026983 AGCCAACACAAACTAATTAAAGG - Intergenic
1000522455 5:162313756-162313778 AGACACTAAAAATGTAATAAAGG + Intergenic
1000797378 5:165681847-165681869 AGAAACCAAAAAGTAATTATAGG - Intergenic
1000805810 5:165790082-165790104 AGGCACCAAGAACTTACAAAAGG - Intergenic
1004739079 6:18439388-18439410 AGACAACAAAATTTTATTACAGG - Intronic
1004893706 6:20126500-20126522 AGACACTAAAAACTTACTGTGGG + Exonic
1005721758 6:28609168-28609190 AGACATGAAAAAGTAATTAAAGG + Intronic
1008067986 6:47070960-47070982 AGAGTTCAAAAACTTACTAAAGG + Intergenic
1008136903 6:47787601-47787623 AGACACGAAATATTTTTTAAAGG - Intronic
1008465347 6:51823968-51823990 TGACCCCTAAAATTTATTAAAGG - Intronic
1008692075 6:53990814-53990836 AGACATCAAACACTTATTGAAGG + Intronic
1008999354 6:57695782-57695804 AGGCACCAAAAACATATGATGGG - Intergenic
1009667965 6:66707188-66707210 AGTCATGAAAAACTTATTCATGG - Intergenic
1009807819 6:68625140-68625162 AGCCACCAGATAATTATTAATGG - Intergenic
1009827648 6:68887745-68887767 AAACACCTAAAATATATTAAAGG + Intronic
1009999744 6:70937044-70937066 AGACACAAAAAAATGATAAAGGG + Intronic
1010129647 6:72476026-72476048 ACAAACCAAAACCTTCTTAATGG - Intergenic
1010480994 6:76354025-76354047 AGGCACCAAAAGCTTATTGAAGG - Intergenic
1011645563 6:89454818-89454840 AGACAACAAAAACATCTAAAGGG - Intronic
1011971841 6:93235112-93235134 ACACAACAAAAACTGAATAAAGG + Intergenic
1012604619 6:101142784-101142806 AGACACCAAGACCTTCTTGAGGG - Intergenic
1013165856 6:107591438-107591460 AGTCATTAAAAACTTAATAAGGG + Intronic
1013168726 6:107617132-107617154 ACACATCAAAACCTCATTAAGGG - Intronic
1013867011 6:114710933-114710955 AGACACCTAAAACTCATTCATGG - Intergenic
1013966140 6:115958187-115958209 AGACACCTAAATCATAATAAGGG + Intronic
1014975158 6:127871634-127871656 AGACATCAAAAATGTAATAAGGG + Intronic
1015113632 6:129621183-129621205 ATACACTTAAAAATTATTAAGGG - Intronic
1015224916 6:130846385-130846407 ATACACCTAAAAATTATTGAAGG - Intronic
1015701791 6:136043865-136043887 AGACACTAGAGAATTATTAAAGG - Intronic
1016073124 6:139764410-139764432 AGATATGCAAAACTTATTAAGGG - Intergenic
1016776693 6:147912199-147912221 AGAAACTAAAAACTTCTTAGTGG + Intergenic
1016982661 6:149867165-149867187 AAACATCAAAACCTTATCAATGG + Intergenic
1017062451 6:150497341-150497363 AAACAATAAAATCTTATTAAAGG - Intergenic
1017207065 6:151814374-151814396 AGAGGCCAAAAACTCTTTAAAGG - Intronic
1019251462 7:15791-15813 AAACTCCAAATACTTATGAATGG - Intergenic
1019292015 7:255406-255428 AGACAAAAAAAACTAATAAATGG - Intronic
1020176097 7:5883376-5883398 AAACACTAAAAACTTAAAAATGG + Intronic
1022170936 7:27830101-27830123 AGACTCAAAAAACTTTTTAAAGG - Intronic
1023950710 7:44842085-44842107 AGTGACCAAAAGCTTCTTAAGGG + Intronic
1027520901 7:79205654-79205676 AGACTACAATAATTTATTAAAGG + Intronic
1027553300 7:79629213-79629235 ATAAACCACAAAATTATTAAAGG - Intergenic
1028269560 7:88771880-88771902 AGACAGCAATAAATGATTAAAGG + Intronic
1028335963 7:89655459-89655481 AGACACCAAAAACTTCTAGAGGG + Intergenic
1030121755 7:106116968-106116990 AGACAACATAAAAATATTAAAGG - Intergenic
1030274102 7:107701044-107701066 TGGCACCTAAAGCTTATTAATGG - Intronic
1031735291 7:125351905-125351927 ATACCCCAGAAACTTATAAAGGG + Intergenic
1031813388 7:126401275-126401297 AGACAGCTGAAACTTACTAAAGG - Intergenic
1032030610 7:128480216-128480238 AGACAGCAACTATTTATTAAGGG - Intronic
1032137511 7:129293648-129293670 AAACCCCAAAAACTTATTTGAGG + Intronic
1032810558 7:135411162-135411184 AGAAAGCAAAAACTAATTCATGG - Intronic
1032812460 7:135434439-135434461 AGAAACCAAAAAATTATTCCTGG + Intronic
1032863716 7:135905308-135905330 AGAAACCAAAAAATTATTCCTGG - Intergenic
1032907708 7:136390079-136390101 ATTCAACAAGAACTTATTAATGG - Intergenic
1032995574 7:137442452-137442474 AGACAACCAAAAGTCATTAAAGG + Intronic
1033003975 7:137540024-137540046 AGACAACTAAAACTCATTCACGG + Intronic
1033763073 7:144457657-144457679 AGACACTAACAAGTTAGTAAGGG + Intronic
1033984764 7:147211539-147211561 AGTCACCAAAAAATTAGGAATGG + Intronic
1034016206 7:147589687-147589709 AGAATCCAAAAGCTTATTAATGG - Intronic
1034089877 7:148353886-148353908 AGACACCAAAAACTTATTAATGG - Intronic
1035149602 7:156858272-156858294 AGACACCAAAAAAAAATTACAGG + Intronic
1035512633 8:204652-204674 AAACTCCAAATACTTATGAATGG - Intergenic
1036121839 8:6026387-6026409 AGACATTAAAAACTGATTAAAGG - Intergenic
1037016585 8:13915141-13915163 AGATACAGAAAACTTATGAATGG + Intergenic
1037470661 8:19206604-19206626 AGACCCCACAATCTTATTACTGG + Intergenic
1038188453 8:25296960-25296982 AGACAAGAAATAATTATTAATGG + Intronic
1040767228 8:50927690-50927712 AAAAACCCAAAACTTTTTAAAGG + Intergenic
1041879672 8:62735291-62735313 AGAAAAGAAAAACTTTTTAAAGG - Intronic
1041910189 8:63080788-63080810 AGACACAAAAAAATGATAAAGGG + Intronic
1043797313 8:84560422-84560444 AGATACCAAAAGCTTGTGAAGGG + Intronic
1043999000 8:86855083-86855105 AGACTCCCTAAACATATTAAGGG - Intergenic
1044575874 8:93768691-93768713 AGATACTTAAAACTTATCAAAGG - Intronic
1044797210 8:95915814-95915836 AGACTTCAAAAACTTAGAAAGGG - Intergenic
1045429434 8:102099274-102099296 AGGCACCAAAGACTTGTCAAGGG + Intronic
1045647984 8:104317846-104317868 AGGGACCAAAAACTAATGAAAGG - Intergenic
1045688159 8:104733284-104733306 AGCCACCAATAACTTCATAAAGG - Intronic
1045720185 8:105100488-105100510 TTACAACAAAAACTTAGTAATGG - Intronic
1045917065 8:107484899-107484921 ATACAGCAAATACATATTAAAGG - Intronic
1046689849 8:117270526-117270548 AGAGATCAGCAACTTATTAAAGG + Intergenic
1046884230 8:119345382-119345404 AGTCACCAAAAACTAATTATTGG - Intergenic
1047272319 8:123373835-123373857 AGTCACTAAAAACAAATTAATGG - Intronic
1047380663 8:124359330-124359352 AGATAGCAAAATCTTACTAAAGG + Intronic
1050374716 9:4958725-4958747 AGACACCAACAATGTACTAATGG + Intergenic
1050401746 9:5263185-5263207 AAACAGCAAAATCTTACTAAAGG - Intergenic
1051101117 9:13522854-13522876 AGATTCCAAACACTTCTTAATGG + Intergenic
1051405952 9:16737735-16737757 AGATGCCAGAAACCTATTAATGG + Intronic
1051451388 9:17201684-17201706 AGACAATAAAAAATTATAAAGGG - Intronic
1051466569 9:17384703-17384725 AAAAACCAAAAACTTTTTCATGG + Intronic
1052114759 9:24636963-24636985 ATACACCAATATTTTATTAAGGG + Intergenic
1053232542 9:36422851-36422873 AGAAAACAAAAACATTTTAAGGG + Intronic
1053609033 9:39691969-39691991 ATACACCCAAAATTTATTAAAGG - Intergenic
1053614632 9:39750759-39750781 TGACACCATAAAGTTTTTAATGG + Intergenic
1053866877 9:42448238-42448260 ATACACCCAAAATTTATTAAAGG - Intergenic
1054238886 9:62591633-62591655 TGACACCATAAAGTTTTTAATGG - Intergenic
1054244490 9:62650429-62650451 ATACACCCAAAATTTATTAAAGG + Intergenic
1054553015 9:66626155-66626177 TGACACCATAAAGTTTTTAATGG - Intergenic
1054558619 9:66684972-66684994 ATACACCCAAAATTTATTAAAGG + Intergenic
1056669239 9:88610170-88610192 AGAAACCAAAAACTGACAAATGG - Intergenic
1058218684 9:102267873-102267895 AGACACCAAAAACATATATTGGG - Intergenic
1058253657 9:102734013-102734035 AAACTCCAAAACCTTGTTAATGG - Intergenic
1058466166 9:105230738-105230760 AAACACCAAAATATTAATAATGG + Intergenic
1059572073 9:115449183-115449205 AGACACAAAAAACATAATGAAGG - Intergenic
1059611808 9:115905929-115905951 AGACACCAAAAACAAACAAATGG - Intergenic
1062749097 9:138237981-138238003 AAACTCCAAATACTTATGAATGG + Intergenic
1186755344 X:12665052-12665074 ACACAACAAAAAATTATAAAGGG - Intronic
1187436098 X:19271259-19271281 TGACTCCAAAGACTTCTTAAGGG + Intergenic
1187659887 X:21532128-21532150 ACAACCCAAAAACTTATTAAAGG - Intronic
1188376600 X:29438184-29438206 AGACACCAAAAGCACAATAACGG - Intronic
1189123166 X:38416889-38416911 AGACACTGTAAACTTCTTAATGG - Intronic
1189126078 X:38448112-38448134 AGGCACCAAAAACTTATATTTGG - Intronic
1190754080 X:53385697-53385719 ATAATCCAAAAACTAATTAAAGG + Intronic
1191928432 X:66341510-66341532 AGACACCAAAAAATGATAAAGGG - Intergenic
1193101311 X:77616024-77616046 ACACACAAAAAGCTTATTGATGG + Intronic
1193475270 X:81956187-81956209 AGACACCCAAAACTTAGTGCTGG - Intergenic
1193654069 X:84176929-84176951 TGACAGCAAACATTTATTAATGG - Intronic
1193654700 X:84185461-84185483 CCACAGGAAAAACTTATTAAGGG - Intronic
1194257311 X:91650619-91650641 AAAAAACAAAAACTTATAAATGG - Intergenic
1196228291 X:113190743-113190765 AGCAGCCAAAAAGTTATTAAGGG - Intergenic
1196254662 X:113502655-113502677 AGACAAGAAAAACCTATAAAGGG - Intergenic
1197153384 X:123244419-123244441 AAACACAAATAACTCATTAAAGG + Intronic
1197205690 X:123788166-123788188 AGACAACCAAAACAAATTAAAGG + Intergenic
1198503150 X:137273070-137273092 AGAGACAAAATACTTTTTAATGG + Intergenic
1199779957 X:151049439-151049461 AGTCAACAAATATTTATTAAGGG + Intergenic
1200575969 Y:4889572-4889594 AAAAACCAAAAACTTATAAATGG - Intergenic