ID: 1034091991

View in Genome Browser
Species Human (GRCh38)
Location 7:148372113-148372135
Sequence CATCGCGTGAACCTGGGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124578
Summary {0: 1, 1: 3, 2: 439, 3: 26484, 4: 97651}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034091987_1034091991 5 Left 1034091987 7:148372085-148372107 CCAGCTACTCGGGAGGCTGAGGC 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272
Right 1034091991 7:148372113-148372135 CATCGCGTGAACCTGGGAGTTGG 0: 1
1: 3
2: 439
3: 26484
4: 97651
1034091985_1034091991 6 Left 1034091985 7:148372084-148372106 CCCAGCTACTCGGGAGGCTGAGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
Right 1034091991 7:148372113-148372135 CATCGCGTGAACCTGGGAGTTGG 0: 1
1: 3
2: 439
3: 26484
4: 97651
1034091983_1034091991 14 Left 1034091983 7:148372076-148372098 CCTGTAGTCCCAGCTACTCGGGA 0: 54379
1: 173656
2: 264604
3: 194654
4: 115454
Right 1034091991 7:148372113-148372135 CATCGCGTGAACCTGGGAGTTGG 0: 1
1: 3
2: 439
3: 26484
4: 97651

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034091991 Original CRISPR CATCGCGTGAACCTGGGAGT TGG Intronic
Too many off-targets to display for this crispr