ID: 1034095008

View in Genome Browser
Species Human (GRCh38)
Location 7:148399626-148399648
Sequence GGGGGAGTTTATTACAGTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 134}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034095008 Original CRISPR GGGGGAGTTTATTACAGTTT AGG (reversed) Intronic
904046008 1:27608757-27608779 GGGAAAGTTTCTTGCAGTTTTGG + Intergenic
904511775 1:31016287-31016309 TTGGAAGTTTATTACAGGTTGGG - Intronic
905998218 1:42400685-42400707 GGGAGAGGTGATTTCAGTTTGGG + Intronic
907278805 1:53331731-53331753 TGGGGAATTCATTACATTTTGGG - Intergenic
910999770 1:93150821-93150843 GAGGGAGTTTATATCAGTTTGGG + Exonic
911218929 1:95226519-95226541 GGGGTATCTCATTACAGTTTGGG + Intronic
911305826 1:96231083-96231105 CGTGGAGATTATTACAGTTCAGG + Intergenic
911383909 1:97150519-97150541 GGGTGAGCTTATTATAGTTCTGG - Intronic
919043375 1:192421362-192421384 GGGAGAATTAATTACATTTTAGG + Intergenic
921481193 1:215666480-215666502 TGGGCTGTTTATGACAGTTTAGG + Intronic
921503265 1:215933314-215933336 GGGGGAGTTTGTTTTATTTTGGG + Intronic
922381768 1:225036464-225036486 GGGAGAGTTTATTAGAGGTTTGG + Intronic
924098325 1:240577636-240577658 TTGGGAAATTATTACAGTTTGGG + Intronic
924387614 1:243513783-243513805 GGAGGAGTTTGTTTCAGTTTAGG - Intronic
1068350218 10:55833853-55833875 GGTGGACATTATTACATTTTTGG + Intergenic
1073905097 10:108269891-108269913 GGGAGAGTTTATTACAACTGTGG + Intergenic
1075746489 10:124731793-124731815 GGGGAAGCATTTTACAGTTTTGG - Intronic
1076517686 10:131057361-131057383 GGGGGCCTTTATTACAGCATAGG - Intergenic
1078021122 11:7656684-7656706 GGGTCAGTTTAATAGAGTTTTGG - Intronic
1080141812 11:28930804-28930826 GGGAGAGTTTATTAGAGGCTTGG + Intergenic
1082732565 11:56818031-56818053 GGGAGAGTTTATTAGAGGCTTGG - Intergenic
1083162609 11:60864392-60864414 GGGGGAGTTTATCAGAGGCTTGG - Intergenic
1086322001 11:85659962-85659984 TGGGTAGTTAATTACAATTTAGG - Intronic
1087724947 11:101706078-101706100 GGATGAATTTATTTCAGTTTAGG - Intronic
1088013549 11:105033183-105033205 TGGGGAGTGTTTTACAGATTGGG - Intronic
1088528609 11:110784605-110784627 AAGTGAGTTTATGACAGTTTGGG + Intergenic
1088678450 11:112219106-112219128 GGGAGAGTTTATTAGAGGCTTGG + Intronic
1090565678 11:127989662-127989684 GGGAAAGTCTACTACAGTTTAGG - Intergenic
1093910257 12:24739485-24739507 GGGTGTGTAGATTACAGTTTAGG + Intergenic
1099237272 12:80096417-80096439 GATGGAGTTGAGTACAGTTTGGG + Intergenic
1100333504 12:93607887-93607909 GTGGGGCTTTATTACAGTTACGG + Intergenic
1104406400 12:128520816-128520838 GGGAGAGTTTATTAGAGGCTTGG + Intronic
1106303272 13:28488502-28488524 TGGGGATTTTATTAAAGTATAGG + Intronic
1106779139 13:33039442-33039464 GGGGGAGTATAATACAATCTTGG + Intronic
1108489006 13:50960611-50960633 GGGTGAGTTTATTAGACATTTGG - Intronic
1112556599 13:100474188-100474210 GGTTTAGTTTATGACAGTTTTGG - Intronic
1116287501 14:42991269-42991291 GGGTGAGTTTCTTAAAGTTAGGG + Intergenic
1117588399 14:57238730-57238752 GGGGGAATTCATTACATGTTTGG + Intronic
1118084939 14:62403991-62404013 GGGGGAGACTGATACAGTTTGGG + Intergenic
1120464731 14:84842159-84842181 GGTAGAGTGTATTACAGTTTTGG + Intergenic
1123711448 15:22990634-22990656 GGAGAAATTTATTACAGTTCTGG - Intronic
1124136080 15:27037476-27037498 GGGAGAGTTTATCAGAGTCTTGG + Intronic
1124716129 15:32063951-32063973 GGTGTCCTTTATTACAGTTTGGG + Intronic
1125986272 15:44055999-44056021 GGAGGAGGTTATTTCAATTTGGG - Intronic
1126102438 15:45128005-45128027 GGGGGAGTTTCCCACACTTTAGG + Intronic
1132719906 16:1310327-1310349 GGGGGAGTTTTATTCTGTTTTGG + Intronic
1135013181 16:18902327-18902349 GTTAGAGTTTATTGCAGTTTAGG - Intronic
1135320114 16:21489926-21489948 GTTAGAGTTTATTGCAGTTTAGG - Intergenic
1135372949 16:21921416-21921438 GTTAGAGTTTATTGCAGTTTAGG - Intergenic
1135438839 16:22449286-22449308 GTTAGAGTTTATTGCAGTTTAGG + Intergenic
1135772923 16:25230973-25230995 TGGAGAGTTTATTACATGTTAGG + Intergenic
1136292207 16:29281871-29281893 GGAGAAGTTTATTACAGGGTTGG + Intergenic
1136330338 16:29571621-29571643 GTTAGAGTTTATTGCAGTTTAGG - Intergenic
1136444966 16:30311344-30311366 GTTAGAGTTTATTGCAGTTTAGG - Intergenic
1138648392 16:58442100-58442122 AGGAGAGTTTATTACAGGCTCGG - Intergenic
1139360567 16:66396908-66396930 GCAGGAGTCCATTACAGTTTGGG - Intronic
1140755797 16:78065537-78065559 GGGAAAGTTTATTACAGCGTTGG + Intronic
1142098099 16:88255824-88255846 GGAGAAGTTTATTACAGGGTTGG + Intergenic
1143428987 17:6865458-6865480 GGTGGACTTTATTACAGATAAGG - Intergenic
1146245170 17:31275174-31275196 GGGGGCTATTATTACACTTTGGG - Intronic
1146685479 17:34838669-34838691 AGGGGAGTGAATTACAGGTTTGG - Intergenic
1147394687 17:40132751-40132773 GGGAGGGTTTATGACAGTCTGGG + Intronic
1148633461 17:49129716-49129738 GGGGAAGTTTATTGCAGGGTTGG + Intergenic
1149199574 17:54167271-54167293 GGGGAAGCTTATTTCATTTTTGG - Intergenic
1152989214 18:347583-347605 GGGGGAATTTACTAGATTTTAGG + Intronic
1153616344 18:6938180-6938202 GAGGGAGTTTATTACGGCTGAGG + Intergenic
1158243269 18:55401909-55401931 GGCGGAGGTCATTAGAGTTTTGG - Intronic
1158702222 18:59758420-59758442 GGGGGAGTTAACTAAAGTGTGGG + Intergenic
1159082220 18:63748224-63748246 GGGGTTGTTTGTTACTGTTTTGG - Intergenic
1160142967 18:76341786-76341808 GGGGAAGTCTCTTATAGTTTGGG - Intergenic
1163422141 19:17219799-17219821 GGGGGTCTTTATTTGAGTTTAGG - Exonic
925135666 2:1523899-1523921 GGGGAGGTTGATTACAGTTGGGG - Intronic
925258000 2:2506453-2506475 GGGGGAGTTTATTGCAGGCTTGG + Intergenic
931039837 2:58285119-58285141 GTGGGAGTTGAGTTCAGTTTAGG - Intergenic
935050681 2:99522547-99522569 GGGAGAGTTTATTAGAGTCTTGG + Intergenic
941588143 2:167385081-167385103 GGGGAAGTTTAGTAAAATTTGGG + Intergenic
942872367 2:180750439-180750461 GGAAGAGTTTGTTAGAGTTTTGG + Intergenic
942875616 2:180793244-180793266 GGAAGATTTTATTACAGTTGAGG - Intergenic
943455868 2:188105863-188105885 GTGGGAGTTTAACACTGTTTTGG - Intergenic
943827282 2:192412661-192412683 GGGGCAATTTAATACAGTTGGGG - Intergenic
947172170 2:227322888-227322910 GGAGAAGTTTATTACAGGGTTGG + Intergenic
948407261 2:237731449-237731471 GGGGGGATTTATTACAGACTGGG - Intronic
1172021523 20:31917900-31917922 GGGAGAGTTTATTAGAGGCTTGG + Intronic
1172421444 20:34821931-34821953 GGGGGAGTTTTTTAAATTTCTGG - Intronic
1177126013 21:17193545-17193567 GGGGAAGTTTATGACAGGGTTGG - Intergenic
1178576505 21:33797022-33797044 GGGGGAAATTTTTACAGTGTTGG + Intronic
1179273567 21:39870060-39870082 CGGGGAGTATATGACACTTTGGG - Intronic
949500733 3:4677786-4677808 GGGAGAGTTTGTTGCTGTTTGGG + Intronic
953065864 3:39470295-39470317 GGGACAGTTTTTAACAGTTTTGG - Intronic
956411728 3:68986403-68986425 GAGGGATTTTATTCCAGTGTAGG - Intronic
961598087 3:128035281-128035303 GGGGTATTTTCTTACAGTTCTGG - Intergenic
963490431 3:145993465-145993487 GGGAGAGTTTATTAGAGGCTTGG - Intergenic
963490437 3:145993525-145993547 GGGAGAGTTTATTAGAGGCTTGG - Intergenic
964506379 3:157404603-157404625 GGGAGAGTTTATTTCATTTGAGG + Intronic
966482308 3:180424579-180424601 GAGGGAGTTTATTACGGCTGAGG - Intergenic
970828832 4:20310814-20310836 GAGAGAGTTTATCACAGTATAGG + Intronic
971039402 4:22734933-22734955 GGGGCTGTTTATTACATTTTTGG - Intergenic
980770413 4:137364685-137364707 AGAGAAGTTTCTTACAGTTTAGG - Intergenic
982905094 4:161058073-161058095 GAGGAAGTTTATTAGAGTTGTGG - Intergenic
987871065 5:23617400-23617422 GGGAGAGTTTATTAAAGGCTTGG + Intergenic
992775433 5:80084736-80084758 TAGGGAGCTTATTACATTTTTGG + Intergenic
994674545 5:102804234-102804256 GGGGGAGCCTTTTAGAGTTTTGG + Intronic
1001565987 5:172699814-172699836 GGGGCAGCTTATTCCAGCTTGGG + Intergenic
1002813688 6:659320-659342 GGGGGCGCTAATGACAGTTTGGG - Intronic
1007690564 6:43698507-43698529 GGGTGAATTTATTAAAGTTGAGG + Intergenic
1010478979 6:76325696-76325718 GGGAGAGCTTATCACAGGTTCGG + Intergenic
1012534854 6:100283274-100283296 GGGAGAGATTATTTTAGTTTAGG + Intergenic
1015717163 6:136204839-136204861 GGAGAAGTTTATTATAGTTAAGG + Intergenic
1015757141 6:136619138-136619160 GGGGGTGTCTTTTTCAGTTTGGG + Intronic
1022836027 7:34116016-34116038 GTGGTATTTTATTATAGTTTTGG + Intronic
1024118302 7:46213211-46213233 TGTGGAGTTTATTACAATTCAGG + Intergenic
1029994009 7:104988996-104989018 GGGGCAGTTTATTGCATCTTTGG - Intergenic
1030854778 7:114541418-114541440 GGGGGAGTTTATAAAATTTAAGG + Intronic
1031433715 7:121706566-121706588 GGAGAAGTTCATCACAGTTTTGG - Intergenic
1032233129 7:130093887-130093909 AGGGTTTTTTATTACAGTTTTGG + Intronic
1033087055 7:138352445-138352467 GTGGGAGTTTACAACATTTTAGG - Intergenic
1034095008 7:148399626-148399648 GGGGGAGTTTATTACAGTTTAGG - Intronic
1034746489 7:153528155-153528177 GGGGGAGCTTATTGCAGGATTGG + Intergenic
1035228062 7:157444435-157444457 GGGTGTGTATATTACACTTTGGG - Intergenic
1036046014 8:5141459-5141481 GGTGGAGTTTAGTACAGAGTGGG - Intergenic
1036346154 8:7965072-7965094 GGTTGGGTTTTTTACAGTTTTGG + Intergenic
1036863286 8:12372077-12372099 GGTTGGGTTTTTTACAGTTTTGG + Intergenic
1040111542 8:43569047-43569069 AGGGGAGTTTTTGCCAGTTTGGG + Intergenic
1044818870 8:96142248-96142270 GAGGTAGTTTGTTCCAGTTTGGG - Intergenic
1046156237 8:110293855-110293877 AGAGGAGTTTATTTCTGTTTGGG + Intergenic
1046884595 8:119351451-119351473 TGGGGAGTTTATGACAATCTAGG + Intergenic
1051296760 9:15604578-15604600 GGGGGAGTTTGTGACGGTATGGG + Intronic
1053462484 9:38281344-38281366 GGGGGAGATCATTACACTTCTGG + Intergenic
1055020778 9:71667231-71667253 AGAGGAGTTTATTTTAGTTTGGG - Intergenic
1057079471 9:92161448-92161470 GGGGGCCTTTATTACAGCATAGG - Intergenic
1058197674 9:101998864-101998886 AGAGGAGATTATTATAGTTTGGG + Intergenic
1059639291 9:116201019-116201041 GGGAGAGTTTATTAAATTCTTGG - Intronic
1060187930 9:121575193-121575215 GGGGGTGTTAAGTACAGTTCAGG - Intronic
1185656618 X:1690633-1690655 GGGTGAGCTTATTACAGGCTTGG + Intergenic
1187026078 X:15436863-15436885 GGGGGAATTTATTATGGTCTAGG + Intronic
1187209633 X:17216642-17216664 GGGGCTTTTTATTTCAGTTTGGG - Intergenic
1193998410 X:88395289-88395311 GGAGCAGTTTTTTACTGTTTAGG + Intergenic
1194871820 X:99141813-99141835 GGGGGAGTATATTTCAAATTGGG - Intergenic
1195046210 X:101056799-101056821 GAGGGAGCTTATTACAGGCTTGG - Intergenic
1195502889 X:105623462-105623484 GGGGCAGTTTTTTTCAGTTCTGG + Intronic
1195883159 X:109613544-109613566 GAGAGTGTTTATTAAAGTTTGGG + Intergenic
1198404589 X:136300049-136300071 GGGAGAGTTTATTAGAGGCTTGG + Intergenic
1200408099 Y:2835044-2835066 GAGGGAGTTTATTACAAGTTTGG + Intergenic