ID: 1034097255

View in Genome Browser
Species Human (GRCh38)
Location 7:148421301-148421323
Sequence CTGATCCTTATTTGGAATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034097250_1034097255 26 Left 1034097250 7:148421252-148421274 CCCATCTTGATAAAATGTGGTTC No data
Right 1034097255 7:148421301-148421323 CTGATCCTTATTTGGAATGAGGG No data
1034097251_1034097255 25 Left 1034097251 7:148421253-148421275 CCATCTTGATAAAATGTGGTTCG No data
Right 1034097255 7:148421301-148421323 CTGATCCTTATTTGGAATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034097255 Original CRISPR CTGATCCTTATTTGGAATGA GGG Intergenic
No off target data available for this crispr