ID: 1034103786

View in Genome Browser
Species Human (GRCh38)
Location 7:148473360-148473382
Sequence CAAGTTCATCACATCCCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034103783_1034103786 9 Left 1034103783 7:148473328-148473350 CCCTTGGAACTGAAACTAGACTC No data
Right 1034103786 7:148473360-148473382 CAAGTTCATCACATCCCTTTGGG No data
1034103782_1034103786 20 Left 1034103782 7:148473317-148473339 CCAGGTTGAATCCCTTGGAACTG No data
Right 1034103786 7:148473360-148473382 CAAGTTCATCACATCCCTTTGGG No data
1034103780_1034103786 27 Left 1034103780 7:148473310-148473332 CCAAACACCAGGTTGAATCCCTT No data
Right 1034103786 7:148473360-148473382 CAAGTTCATCACATCCCTTTGGG No data
1034103784_1034103786 8 Left 1034103784 7:148473329-148473351 CCTTGGAACTGAAACTAGACTCA No data
Right 1034103786 7:148473360-148473382 CAAGTTCATCACATCCCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034103786 Original CRISPR CAAGTTCATCACATCCCTTT GGG Intergenic
No off target data available for this crispr