ID: 1034104810

View in Genome Browser
Species Human (GRCh38)
Location 7:148481381-148481403
Sequence GATGGTTGGCAGGATGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034104810_1034104825 22 Left 1034104810 7:148481381-148481403 CCTCCAGCATCCTGCCAACCATC No data
Right 1034104825 7:148481426-148481448 GCTTGGGGGGAAGTTCATAAGGG No data
1034104810_1034104819 7 Left 1034104810 7:148481381-148481403 CCTCCAGCATCCTGCCAACCATC No data
Right 1034104819 7:148481411-148481433 TAGTCTCGTGCCCAGGCTTGGGG No data
1034104810_1034104816 0 Left 1034104810 7:148481381-148481403 CCTCCAGCATCCTGCCAACCATC No data
Right 1034104816 7:148481404-148481426 TGGTCATTAGTCTCGTGCCCAGG No data
1034104810_1034104824 21 Left 1034104810 7:148481381-148481403 CCTCCAGCATCCTGCCAACCATC No data
Right 1034104824 7:148481425-148481447 GGCTTGGGGGGAAGTTCATAAGG No data
1034104810_1034104818 6 Left 1034104810 7:148481381-148481403 CCTCCAGCATCCTGCCAACCATC No data
Right 1034104818 7:148481410-148481432 TTAGTCTCGTGCCCAGGCTTGGG No data
1034104810_1034104821 9 Left 1034104810 7:148481381-148481403 CCTCCAGCATCCTGCCAACCATC No data
Right 1034104821 7:148481413-148481435 GTCTCGTGCCCAGGCTTGGGGGG No data
1034104810_1034104820 8 Left 1034104810 7:148481381-148481403 CCTCCAGCATCCTGCCAACCATC No data
Right 1034104820 7:148481412-148481434 AGTCTCGTGCCCAGGCTTGGGGG No data
1034104810_1034104817 5 Left 1034104810 7:148481381-148481403 CCTCCAGCATCCTGCCAACCATC No data
Right 1034104817 7:148481409-148481431 ATTAGTCTCGTGCCCAGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034104810 Original CRISPR GATGGTTGGCAGGATGCTGG AGG (reversed) Intergenic
No off target data available for this crispr