ID: 1034104844

View in Genome Browser
Species Human (GRCh38)
Location 7:148481610-148481632
Sequence CAGCCCATCCAGAAGTTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034104844_1034104852 14 Left 1034104844 7:148481610-148481632 CCCCACAACTTCTGGATGGGCTG No data
Right 1034104852 7:148481647-148481669 CATAGGGAAGCCCCTGGCCAGGG No data
1034104844_1034104847 -3 Left 1034104844 7:148481610-148481632 CCCCACAACTTCTGGATGGGCTG No data
Right 1034104847 7:148481630-148481652 CTGTAGTGAAGCCGTAGCATAGG No data
1034104844_1034104848 -2 Left 1034104844 7:148481610-148481632 CCCCACAACTTCTGGATGGGCTG No data
Right 1034104848 7:148481631-148481653 TGTAGTGAAGCCGTAGCATAGGG No data
1034104844_1034104851 13 Left 1034104844 7:148481610-148481632 CCCCACAACTTCTGGATGGGCTG No data
Right 1034104851 7:148481646-148481668 GCATAGGGAAGCCCCTGGCCAGG No data
1034104844_1034104853 21 Left 1034104844 7:148481610-148481632 CCCCACAACTTCTGGATGGGCTG No data
Right 1034104853 7:148481654-148481676 AAGCCCCTGGCCAGGGCAGAAGG No data
1034104844_1034104850 8 Left 1034104844 7:148481610-148481632 CCCCACAACTTCTGGATGGGCTG No data
Right 1034104850 7:148481641-148481663 CCGTAGCATAGGGAAGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034104844 Original CRISPR CAGCCCATCCAGAAGTTGTG GGG (reversed) Intergenic
No off target data available for this crispr