ID: 1034105326

View in Genome Browser
Species Human (GRCh38)
Location 7:148484823-148484845
Sequence ATTAAAACTAATGTAATTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034105326_1034105328 14 Left 1034105326 7:148484823-148484845 CCTCTAATTACATTAGTTTTAAT No data
Right 1034105328 7:148484860-148484882 ATGTTCTTCTCCCCTGTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034105326 Original CRISPR ATTAAAACTAATGTAATTAG AGG (reversed) Intergenic