ID: 1034107240

View in Genome Browser
Species Human (GRCh38)
Location 7:148500946-148500968
Sequence CACATGGAGGAGGCATTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034107240_1034107247 19 Left 1034107240 7:148500946-148500968 CCCTACAATGCCTCCTCCATGTG No data
Right 1034107247 7:148500988-148501010 CTTGAAACCCAGAGGGCACCTGG No data
1034107240_1034107245 11 Left 1034107240 7:148500946-148500968 CCCTACAATGCCTCCTCCATGTG No data
Right 1034107245 7:148500980-148501002 TTTTATTTCTTGAAACCCAGAGG No data
1034107240_1034107246 12 Left 1034107240 7:148500946-148500968 CCCTACAATGCCTCCTCCATGTG No data
Right 1034107246 7:148500981-148501003 TTTATTTCTTGAAACCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034107240 Original CRISPR CACATGGAGGAGGCATTGTA GGG (reversed) Intergenic
No off target data available for this crispr