ID: 1034107241

View in Genome Browser
Species Human (GRCh38)
Location 7:148500947-148500969
Sequence ACACATGGAGGAGGCATTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034107241_1034107247 18 Left 1034107241 7:148500947-148500969 CCTACAATGCCTCCTCCATGTGT No data
Right 1034107247 7:148500988-148501010 CTTGAAACCCAGAGGGCACCTGG No data
1034107241_1034107246 11 Left 1034107241 7:148500947-148500969 CCTACAATGCCTCCTCCATGTGT No data
Right 1034107246 7:148500981-148501003 TTTATTTCTTGAAACCCAGAGGG No data
1034107241_1034107245 10 Left 1034107241 7:148500947-148500969 CCTACAATGCCTCCTCCATGTGT No data
Right 1034107245 7:148500980-148501002 TTTTATTTCTTGAAACCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034107241 Original CRISPR ACACATGGAGGAGGCATTGT AGG (reversed) Intergenic