ID: 1034107244

View in Genome Browser
Species Human (GRCh38)
Location 7:148500962-148500984
Sequence TAAAACGTGAGTTGAACACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034107244_1034107247 3 Left 1034107244 7:148500962-148500984 CCATGTGTTCAACTCACGTTTTA No data
Right 1034107247 7:148500988-148501010 CTTGAAACCCAGAGGGCACCTGG No data
1034107244_1034107246 -4 Left 1034107244 7:148500962-148500984 CCATGTGTTCAACTCACGTTTTA No data
Right 1034107246 7:148500981-148501003 TTTATTTCTTGAAACCCAGAGGG No data
1034107244_1034107251 21 Left 1034107244 7:148500962-148500984 CCATGTGTTCAACTCACGTTTTA No data
Right 1034107251 7:148501006-148501028 CCTGGTTCTCACCTGCCTCCAGG No data
1034107244_1034107245 -5 Left 1034107244 7:148500962-148500984 CCATGTGTTCAACTCACGTTTTA No data
Right 1034107245 7:148500980-148501002 TTTTATTTCTTGAAACCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034107244 Original CRISPR TAAAACGTGAGTTGAACACA TGG (reversed) Intergenic
No off target data available for this crispr