ID: 1034107246

View in Genome Browser
Species Human (GRCh38)
Location 7:148500981-148501003
Sequence TTTATTTCTTGAAACCCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034107240_1034107246 12 Left 1034107240 7:148500946-148500968 CCCTACAATGCCTCCTCCATGTG No data
Right 1034107246 7:148500981-148501003 TTTATTTCTTGAAACCCAGAGGG No data
1034107238_1034107246 14 Left 1034107238 7:148500944-148500966 CCCCCTACAATGCCTCCTCCATG No data
Right 1034107246 7:148500981-148501003 TTTATTTCTTGAAACCCAGAGGG No data
1034107241_1034107246 11 Left 1034107241 7:148500947-148500969 CCTACAATGCCTCCTCCATGTGT No data
Right 1034107246 7:148500981-148501003 TTTATTTCTTGAAACCCAGAGGG No data
1034107242_1034107246 2 Left 1034107242 7:148500956-148500978 CCTCCTCCATGTGTTCAACTCAC No data
Right 1034107246 7:148500981-148501003 TTTATTTCTTGAAACCCAGAGGG No data
1034107244_1034107246 -4 Left 1034107244 7:148500962-148500984 CCATGTGTTCAACTCACGTTTTA No data
Right 1034107246 7:148500981-148501003 TTTATTTCTTGAAACCCAGAGGG No data
1034107239_1034107246 13 Left 1034107239 7:148500945-148500967 CCCCTACAATGCCTCCTCCATGT No data
Right 1034107246 7:148500981-148501003 TTTATTTCTTGAAACCCAGAGGG No data
1034107243_1034107246 -1 Left 1034107243 7:148500959-148500981 CCTCCATGTGTTCAACTCACGTT No data
Right 1034107246 7:148500981-148501003 TTTATTTCTTGAAACCCAGAGGG No data
1034107237_1034107246 17 Left 1034107237 7:148500941-148500963 CCACCCCCTACAATGCCTCCTCC No data
Right 1034107246 7:148500981-148501003 TTTATTTCTTGAAACCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034107246 Original CRISPR TTTATTTCTTGAAACCCAGA GGG Intergenic
No off target data available for this crispr