ID: 1034107251

View in Genome Browser
Species Human (GRCh38)
Location 7:148501006-148501028
Sequence CCTGGTTCTCACCTGCCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034107242_1034107251 27 Left 1034107242 7:148500956-148500978 CCTCCTCCATGTGTTCAACTCAC No data
Right 1034107251 7:148501006-148501028 CCTGGTTCTCACCTGCCTCCAGG No data
1034107244_1034107251 21 Left 1034107244 7:148500962-148500984 CCATGTGTTCAACTCACGTTTTA No data
Right 1034107251 7:148501006-148501028 CCTGGTTCTCACCTGCCTCCAGG No data
1034107243_1034107251 24 Left 1034107243 7:148500959-148500981 CCTCCATGTGTTCAACTCACGTT No data
Right 1034107251 7:148501006-148501028 CCTGGTTCTCACCTGCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034107251 Original CRISPR CCTGGTTCTCACCTGCCTCC AGG Intergenic
No off target data available for this crispr