ID: 1034110746

View in Genome Browser
Species Human (GRCh38)
Location 7:148535506-148535528
Sequence CATTTCTGCCAGAGCCTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034110740_1034110746 18 Left 1034110740 7:148535465-148535487 CCGGAGCGCAACAGAGGAGCCTG No data
Right 1034110746 7:148535506-148535528 CATTTCTGCCAGAGCCTGGGGGG No data
1034110741_1034110746 -1 Left 1034110741 7:148535484-148535506 CCTGTCAGATATAGAAACTGTAC No data
Right 1034110746 7:148535506-148535528 CATTTCTGCCAGAGCCTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034110746 Original CRISPR CATTTCTGCCAGAGCCTGGG GGG Intergenic
No off target data available for this crispr