ID: 1034113301

View in Genome Browser
Species Human (GRCh38)
Location 7:148559386-148559408
Sequence CTATGGGGAAGAAGGGAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034113301_1034113312 26 Left 1034113301 7:148559386-148559408 CCCTATTCCCTTCTTCCCCATAG No data
Right 1034113312 7:148559435-148559457 TACATAGTACTTTGATTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034113301 Original CRISPR CTATGGGGAAGAAGGGAATA GGG (reversed) Intergenic
No off target data available for this crispr