ID: 1034116683

View in Genome Browser
Species Human (GRCh38)
Location 7:148589729-148589751
Sequence CAGAGTAATCTTAGGGATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034116677_1034116683 3 Left 1034116677 7:148589703-148589725 CCATTAAGCTTTTCCCCAGCAGT No data
Right 1034116683 7:148589729-148589751 CAGAGTAATCTTAGGGATTCTGG No data
1034116678_1034116683 -10 Left 1034116678 7:148589716-148589738 CCCCAGCAGTACACAGAGTAATC No data
Right 1034116683 7:148589729-148589751 CAGAGTAATCTTAGGGATTCTGG No data
1034116676_1034116683 4 Left 1034116676 7:148589702-148589724 CCCATTAAGCTTTTCCCCAGCAG No data
Right 1034116683 7:148589729-148589751 CAGAGTAATCTTAGGGATTCTGG No data
1034116673_1034116683 28 Left 1034116673 7:148589678-148589700 CCTTCCCTCAAGGGTGGTGTTGA No data
Right 1034116683 7:148589729-148589751 CAGAGTAATCTTAGGGATTCTGG No data
1034116675_1034116683 23 Left 1034116675 7:148589683-148589705 CCTCAAGGGTGGTGTTGAGCCCA No data
Right 1034116683 7:148589729-148589751 CAGAGTAATCTTAGGGATTCTGG No data
1034116674_1034116683 24 Left 1034116674 7:148589682-148589704 CCCTCAAGGGTGGTGTTGAGCCC No data
Right 1034116683 7:148589729-148589751 CAGAGTAATCTTAGGGATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034116683 Original CRISPR CAGAGTAATCTTAGGGATTC TGG Intergenic
No off target data available for this crispr