ID: 1034123744

View in Genome Browser
Species Human (GRCh38)
Location 7:148652286-148652308
Sequence GCCCTCCATAGCCCCCTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034123744_1034123747 11 Left 1034123744 7:148652286-148652308 CCCTTAAGGGGGCTATGGAGGGC No data
Right 1034123747 7:148652320-148652342 AAACTAAAATGGAGTCTGTCTGG 0: 23
1: 16
2: 9
3: 33
4: 360
1034123744_1034123746 0 Left 1034123744 7:148652286-148652308 CCCTTAAGGGGGCTATGGAGGGC No data
Right 1034123746 7:148652309-148652331 TGCAAGTGAAGAAACTAAAATGG No data
1034123744_1034123748 25 Left 1034123744 7:148652286-148652308 CCCTTAAGGGGGCTATGGAGGGC No data
Right 1034123748 7:148652334-148652356 TCTGTCTGGCTCTCTCTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034123744 Original CRISPR GCCCTCCATAGCCCCCTTAA GGG (reversed) Intergenic
No off target data available for this crispr