ID: 1034124909

View in Genome Browser
Species Human (GRCh38)
Location 7:148662758-148662780
Sequence ATGTCCAAGGGCCCTGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 920
Summary {0: 2, 1: 2, 2: 26, 3: 156, 4: 734}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034124909 Original CRISPR ATGTCCAAGGGCCCTGTGGT GGG Intergenic
900867773 1:5280696-5280718 AAGTGCAAAGGCCCTGAGGTGGG - Intergenic
900939158 1:5786744-5786766 AGGTGCAAAGGCCCTGAGGTGGG + Intergenic
901173894 1:7284723-7284745 ACGTGCAAAGGCCTTGTGGTGGG - Intronic
901183197 1:7355853-7355875 ATGTGCAAAGGCCCTGGGGTGGG - Intronic
901396384 1:8985186-8985208 ATGTGCAAAGGCCCTGTGGCCGG - Intergenic
901425499 1:9180300-9180322 AAGTGCAAAGGCCCTGTGTTTGG - Intergenic
901781056 1:11594841-11594863 ATGTGCAAAGGCCCTGGGGCTGG - Intergenic
901785830 1:11623862-11623884 ATGTGCAAAGGCCCTGGGGTGGG + Intergenic
902107669 1:14051312-14051334 CTGTCCTAGGGCCCTGTCCTTGG - Intergenic
902195590 1:14795789-14795811 ATGTGCAAAGGCCCTGAGGGAGG - Intronic
902258852 1:15208706-15208728 AAGTTCCAAGGCCCTGTGGTAGG + Intronic
902278942 1:15360358-15360380 ATGTGCTAAGGCCCTGGGGTGGG + Intronic
902572409 1:17355194-17355216 ATGTGCAAAGGCCCTGAGGCAGG + Intronic
902619420 1:17642306-17642328 AAGTACAAAGGCCCTGAGGTAGG + Intronic
902738558 1:18418046-18418068 ATGGACAAAGGCCCTGTGGCTGG - Intergenic
903019654 1:20385143-20385165 ATGTGCAACGGCCCTGGGGTGGG - Intergenic
903050758 1:20599170-20599192 TTGTGCAAAGGCCCTGTGGCAGG + Intronic
903286337 1:22279332-22279354 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
903353022 1:22729585-22729607 CAGTGCAAAGGCCCTGTGGTGGG - Intronic
903662842 1:24989263-24989285 ACGTGCAAAGGCCCTGAGGTGGG + Intergenic
903663222 1:24991325-24991347 ATGAGCAAGGGCCCAGGGGTTGG - Intergenic
903678386 1:25081031-25081053 CTGTACAAAGGCCCTGTGGCGGG - Intergenic
903681831 1:25102596-25102618 AAGTGCAAGAGCCCTGAGGTTGG - Intergenic
903757764 1:25674651-25674673 GTGTGCAAAGGCCCTGTGGCAGG + Intronic
903765149 1:25729226-25729248 ATGTGCAAAGGCCCTGAGGTAGG - Intronic
903772532 1:25772883-25772905 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
903926008 1:26831246-26831268 AAGTGCAAAGGCCCTGAGGTAGG + Intronic
903929791 1:26855577-26855599 ATGGCCCAGGGCCCTGAGGCTGG - Exonic
904273609 1:29366394-29366416 ATGTGTAAAGGCCCTGTGGTGGG + Intergenic
904347395 1:29882169-29882191 GTGTACAAAGGCCCTGGGGTGGG + Intergenic
904356401 1:29942871-29942893 ATGTGCAAAGGCCCTGAGGCAGG + Intergenic
904435146 1:30490179-30490201 ATGTGCAAAGGCCCTGGGGCAGG + Intergenic
904457964 1:30658545-30658567 ATGGGCAAAGGCCCTGTGGCAGG + Intergenic
904698566 1:32344713-32344735 ATGTTCAAAGGCCCTGAGGCAGG - Intergenic
904799931 1:33085460-33085482 AGGTGCAAAGGCCCTGAGGTGGG + Intronic
904905875 1:33896883-33896905 ACGTGCAAAGGCCCTGAGGTGGG + Intronic
904910325 1:33929802-33929824 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
904948296 1:34215231-34215253 AAGTGCAAGGGCTCTGAGGTGGG + Intronic
905180716 1:36164530-36164552 ATGTGCAAAGGCCCTGTGGCAGG + Intronic
905421709 1:37850669-37850691 ATGACCAGCGGCCTTGTGGTAGG + Intronic
905451748 1:38061478-38061500 AAGTGCAAAGGCCCTGCGGTGGG + Intergenic
905558835 1:38909809-38909831 ATGTCCAAAGGCACAGTTGTTGG - Intronic
905634234 1:39538712-39538734 ATGTGCAAAGGCCCTGAGGCAGG + Intergenic
905914482 1:41675297-41675319 ATGTACAAAGGCCCTGAGGCAGG - Intronic
905937310 1:41834878-41834900 AAGTGCAATGGCCCTGAGGTGGG + Intronic
905967549 1:42112064-42112086 ATGTGCAAAGGTCCTGTGGTAGG + Intergenic
906590493 1:47020581-47020603 GTGTCCCAGGCCCCTGTGCTGGG - Intergenic
907047291 1:51307033-51307055 ACGTCCAAAGGCCCTGAGGTCGG + Intronic
907052230 1:51337289-51337311 AAGTCCAAAGGGCCTGAGGTGGG - Intronic
907246509 1:53112664-53112686 ATGTCCAAAGGCCCTGGGAAAGG + Intronic
907541422 1:55218536-55218558 ATGTGCAAAGGTCCTGTTGTGGG + Intergenic
907716333 1:56929716-56929738 ATATGCAAAGGCCCTGTGGTAGG - Intronic
907825856 1:58016227-58016249 ATGTCCAAGGGCAGAATGGTTGG - Intronic
908816952 1:68044167-68044189 ATTTCCAGGGACCCTGTGGTAGG + Intergenic
910184403 1:84521462-84521484 AAGTACAAGGGTCCTGAGGTAGG - Intergenic
910433852 1:87185286-87185308 GTGTGCAAAGGCCCTGAGGTGGG - Intergenic
910528266 1:88206007-88206029 ATGTCCAAGGGCCATGGTGCAGG - Intergenic
910727610 1:90355402-90355424 ATGTCCCAAAGCCCTGAGGTAGG + Intergenic
911712078 1:101085223-101085245 ATATACAAAGGCCCTGAGGTGGG + Intergenic
913689778 1:121268303-121268325 ATATGCAAAGGCCCTGAGGTGGG + Intronic
914147821 1:145011969-145011991 ATATGCAAAGGCCCTGAGGTGGG - Intronic
915021591 1:152784939-152784961 ATTTCCAAGGACCCTTTGTTGGG - Intronic
915217601 1:154350472-154350494 ACACCCCAGGGCCCTGTGGTGGG + Exonic
915891685 1:159779676-159779698 ATGGCCAAGTGCCCTGGGCTTGG + Intergenic
915986624 1:160472316-160472338 AAGTGCAAAGGCCCTGAGGTAGG + Intergenic
916504418 1:165415232-165415254 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
916627264 1:166571780-166571802 ATGTGCAAAGGCCTTGAGGTAGG + Intergenic
917537105 1:175882365-175882387 AAGTGCAAAGGCCCTGTGGCAGG + Intergenic
917766413 1:178223448-178223470 ATGAGCAAGAGCCCTGTGGTGGG + Intronic
917808683 1:178636808-178636830 GTGTGCAAGGGCCCTGTGGTTGG - Intergenic
918080551 1:181204659-181204681 AGGTGCAAATGCCCTGTGGTAGG + Intergenic
919658630 1:200221775-200221797 ATGTGCAAAGGCCCAGAGGTGGG - Intergenic
919803973 1:201369733-201369755 TTGTCCAGGGGCCCTGTTCTGGG - Intronic
920053106 1:203175242-203175264 AAGTGCACAGGCCCTGTGGTTGG - Intronic
920292984 1:204936966-204936988 TTGTGCAAAGGCCCTGTGGCAGG - Intronic
920477099 1:206286780-206286802 ATATGCAAAGGCCCTGAGGTGGG + Intronic
920541282 1:206780006-206780028 ATGTGCAAAGGCCCTGTGATAGG - Intergenic
921333011 1:214058695-214058717 AAGTGCAAAGGCCCTGTGTTTGG + Intergenic
921385924 1:214569622-214569644 ATACCCAAGGGCCCTGAGATAGG - Intergenic
922413641 1:225399472-225399494 CTGTGCAATGTCCCTGTGGTTGG + Intergenic
922997383 1:229975238-229975260 AGGTGCAAAGGCCCTGTGGCTGG + Intergenic
923139916 1:231152370-231152392 ATGCCCTAGGGACCTGTGGAAGG - Intergenic
923554676 1:234991294-234991316 CTGTGCAAAGGCCCTATGGTAGG - Intergenic
924349724 1:243103296-243103318 ATGTCCAAGGCCAATGGGGTGGG + Intergenic
924476170 1:244383696-244383718 ATGTGCAAAGGCCTTGTGGCAGG + Intronic
924626233 1:245698458-245698480 CTGTCCAAAGGCCCTTTGCTGGG - Intronic
924799413 1:247316731-247316753 AAGTCCAAGGGCCAGGTGGGTGG + Intronic
1065982441 10:30913377-30913399 ATGGGCAAAGACCCTGTGGTGGG - Intronic
1066482385 10:35809479-35809501 ATGTGCAAAGGCCCTGAGGTGGG - Intergenic
1067231878 10:44417857-44417879 TTGTGCAAAGGCCCTGAGGTAGG + Intergenic
1067982887 10:51107148-51107170 AAGTCCAAGGGCCCTAAGGTAGG + Intronic
1068702902 10:60038852-60038874 ATGTGCAAGCACCCTGAGGTGGG - Intronic
1069623443 10:69852044-69852066 AAGTGCAAAGGCCCTGGGGTGGG - Intronic
1069790056 10:71013721-71013743 ATGTGCAAAGGCCCTATGGCAGG + Intergenic
1069890825 10:71651588-71651610 ATGTGCAAAGGCCCCGTGGCTGG + Intronic
1070073080 10:73108456-73108478 ATATGCAAAGGCCCTGGGGTGGG - Intergenic
1070341787 10:75504688-75504710 ATGTGCAAAGGCCTTGTGGGAGG + Intronic
1070645306 10:78198043-78198065 ATGTGCAAAGGCCCTGAGGTAGG + Intergenic
1070656636 10:78276113-78276135 AAGTGCAAAGGCCCTGTGGCTGG - Intergenic
1070719648 10:78747176-78747198 ATGAGCAAAGGCCCTGGGGTGGG - Intergenic
1071818096 10:89252952-89252974 AGGTACAAAGGCCCTGTGGTAGG + Intronic
1071890972 10:90006705-90006727 ATGTGCAAATGCCCTGAGGTGGG + Intergenic
1072507067 10:96078804-96078826 ATATGCAAAGGACCTGTGGTAGG - Intergenic
1072547175 10:96448735-96448757 AAGTGCAAAGGCCCTGGGGTGGG + Intronic
1072740694 10:97907390-97907412 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
1072858768 10:98980146-98980168 TTGTCCAAGGGCACTTAGGTTGG - Intronic
1073402748 10:103272299-103272321 ATGTCCAAGGCCCCTGGAGTAGG - Intergenic
1073559789 10:104486982-104487004 ATGTGCAAAGGTCCTGTGGTAGG + Intergenic
1073663550 10:105504847-105504869 ATGTGCAAAGACCCTGTGGCAGG + Intergenic
1073970037 10:109037743-109037765 ATATTCAAGGGACCTGTGATGGG - Intergenic
1074600600 10:114909503-114909525 ATGTGCAAAGGCCCTGTGGTGGG - Intergenic
1075302277 10:121335585-121335607 AAGTGCAAAGGCCCTGGGGTGGG - Intergenic
1075420485 10:122296926-122296948 ATGTGCAAAGGCCCTGGGGCAGG - Intronic
1075552118 10:123400422-123400444 AAGTGCAAGGGCCCTGGGGCAGG - Intergenic
1075840067 10:125493985-125494007 ATGGCCCAGGCCCCTGTGCTGGG - Intergenic
1075970643 10:126649482-126649504 GCGTGCGAGGGCCCTGTGGTGGG - Intronic
1076816486 10:132917498-132917520 ATGTCCAGGGTCCCTGTGATGGG - Intronic
1077019114 11:409704-409726 AGGGCCAAGGGCCCAGTGGGAGG + Intronic
1077433164 11:2526087-2526109 AGGTGCACGGGCCCTGAGGTGGG + Intronic
1077797343 11:5506425-5506447 ATGTACAAAGGCACTGAGGTAGG - Intronic
1078087256 11:8241552-8241574 ATGTGCAAAGGCCCTGAGGCAGG - Intronic
1078250051 11:9609457-9609479 AAGTCCAAGGGCCTTGAGGTGGG + Intergenic
1078458802 11:11497072-11497094 AGGTGCAAAGGCCCTGAGGTGGG - Intronic
1079078774 11:17399451-17399473 GTGTGCAAAGGCCCTGGGGTAGG - Intronic
1079130018 11:17741804-17741826 ATGTGCAAAGGCCCTGAGGCAGG - Intronic
1079299370 11:19263950-19263972 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1079397435 11:20077329-20077351 ATGTACAAGGGCCCTAAGATGGG + Intronic
1079633629 11:22708926-22708948 ATGTGCAAGAAGCCTGTGGTGGG + Intronic
1080392839 11:31864448-31864470 TTGTGCAAGGGCCCTGTGCTAGG + Intronic
1081015089 11:37867661-37867683 ATATCCAAAGGCTCTGGGGTAGG - Intergenic
1081280597 11:41205080-41205102 ATATCCAAAGGCCCTGAGGTGGG + Intronic
1081398236 11:42612496-42612518 ATTGCCAGGGGCCCTGGGGTGGG + Intergenic
1081583558 11:44369051-44369073 AGGTGCAAAGGCCCTGGGGTAGG + Intergenic
1081603089 11:44508876-44508898 ATGTGCAAAGGTCCTGTGATAGG - Intergenic
1081634815 11:44714080-44714102 AGGTGCAAAGGCCCTGGGGTGGG + Intergenic
1081683559 11:45025876-45025898 ATATGCAAAGGCCCTGTGGAGGG + Intergenic
1081796045 11:45820654-45820676 AGGTGCAAAGGCCCTGGGGTGGG + Intergenic
1081852366 11:46282529-46282551 ATGTGCAAGGGCTCTGAGGCAGG - Intronic
1083064772 11:59913486-59913508 AGGTACAAGAGCCCTGAGGTGGG + Intergenic
1083303492 11:61751098-61751120 ATGTGCCAAGGCCCTGTGGCAGG + Intergenic
1083611963 11:64008576-64008598 ATGTGCAAAGGCCCGGTGCTAGG + Intronic
1083845033 11:65326666-65326688 GTTTCCCAGGGCCCTGTGGCTGG - Intergenic
1083864895 11:65448424-65448446 GTTTCCCAGGGCCCTGTGGCTGG - Intergenic
1083993293 11:66259434-66259456 ATGTGCAAAGGTCCTGGGGTAGG + Intronic
1084255883 11:67942377-67942399 ATGTGCAAAGGCCCCGTGGCAGG + Intergenic
1084294430 11:68202347-68202369 AAGTGCAAAGGCCCTGTGGTGGG - Intronic
1084470988 11:69358819-69358841 ATGTGCTAAGGCCCTGTGGCAGG - Intronic
1084557539 11:69883860-69883882 AACTCCCAGGGCCCTGTGGGTGG - Intergenic
1085086703 11:73672758-73672780 ATGTCCTAGGGCTTTGTGGAGGG - Intergenic
1085449083 11:76621315-76621337 ATGTACAAAGGCCCTGTGGCTGG + Intergenic
1085633407 11:78138919-78138941 AAGTTCAAAGGCCCTGTGGCAGG - Intronic
1085865731 11:80289850-80289872 ATGTACAAAGGCACTGTGGTAGG - Intergenic
1086094148 11:83033813-83033835 ATGCCCAAGGGGCTTGAGGTTGG - Intronic
1086308482 11:85508349-85508371 AAGTGCAAGGGCCTTGTGGCAGG - Intronic
1087166974 11:95014628-95014650 GTGTCCAAGGCCCCTGTGCTGGG + Intergenic
1087170332 11:95043346-95043368 GTGTCCCAGGCCCCTGTGCTGGG + Intergenic
1087218466 11:95520101-95520123 CTGTGCAAAGGCCCTGTGGTGGG - Intergenic
1087282451 11:96227070-96227092 AGGTACAAGGGCCCCGAGGTAGG - Intronic
1087947207 11:104177208-104177230 ATTTGCAAAGGCCCTGTGGTGGG + Intergenic
1088706525 11:112468884-112468906 ATGTGCAAAGACCCTGAGGTGGG - Intergenic
1088798037 11:113281180-113281202 ATGTGCAAAGGTCCTGAGGTAGG + Intergenic
1089109728 11:116045751-116045773 ATGTGCAAAGGCCCTGTGGTAGG - Intergenic
1089327887 11:117669784-117669806 ATGTGCAAAGGCCCTGGGGCAGG + Intronic
1089574969 11:119435543-119435565 GTATTCAAGGGCCCTGAGGTGGG - Intergenic
1089654076 11:119934451-119934473 ACGTGCAAAGGTCCTGTGGTAGG - Intergenic
1090012882 11:123061302-123061324 ATGTCCAAGGGACCTGCAGTTGG - Exonic
1090260960 11:125319811-125319833 TTGTGCAAAGGCCCTGTGGTGGG + Intronic
1091307183 11:134543788-134543810 ATGTGCAAAGGCCCCGGGGTTGG - Intergenic
1091895236 12:4097451-4097473 ATGTCGAAGGGACCTGCAGTTGG + Intergenic
1091978300 12:4844526-4844548 ATGTGCAAAGGCCCTGAGGTGGG + Intronic
1091979274 12:4852651-4852673 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1092175266 12:6400409-6400431 ACGTGCAAAGGCCCTGTGATAGG + Intergenic
1092426122 12:8377117-8377139 ATGTGCAAAGGCCCCGTGGCAGG + Intergenic
1092762228 12:11820586-11820608 AAGTCCAAAGGCCCTGAGGTGGG + Intronic
1092877896 12:12864430-12864452 ATGTGCAAAGTCCCTGGGGTGGG - Intergenic
1092896039 12:13011283-13011305 ACGTGCAAAGGCCCTGAGGTGGG + Intergenic
1093487237 12:19665254-19665276 ATGGCCAAGGGCTTTGTGGAAGG + Intronic
1093959893 12:25260672-25260694 AGGTGCAAAGGCCCTGAGGTAGG - Intergenic
1095459958 12:42433196-42433218 ATGACCAAGAGCCATGTGGATGG - Intronic
1095856910 12:46870376-46870398 AAGTCCATGAGCCCTGTGGGAGG + Intergenic
1095886507 12:47194030-47194052 ATGACCAAGGGCCCTGCAGGTGG - Intronic
1095926380 12:47583718-47583740 AAGTGCAAAGGCCCTGAGGTAGG + Intergenic
1098134900 12:67391842-67391864 ATGTGCAAAGGCCCTGAGGCAGG + Intergenic
1098230043 12:68363920-68363942 ATGTACAAGAGCCCTGAGGAGGG - Intergenic
1099434144 12:82623514-82623536 ATGTCCCAGGGCTCTCTGCTGGG + Intergenic
1100200970 12:92297403-92297425 ATGTGCCAGGGCCCTGGGTTAGG - Intergenic
1101115745 12:101529702-101529724 ATTTACAAAGGCCCTGAGGTGGG - Intergenic
1101718255 12:107330103-107330125 ATGTGCAAAGGGCCTGTGGCAGG + Intronic
1101733200 12:107443506-107443528 AAGTGCAAAGGCCCTGAGGTAGG + Intronic
1101744323 12:107526986-107527008 AGGTGCAAAGGCCTTGTGGTAGG - Intronic
1101815793 12:108145152-108145174 ATGTGCAAAGGTCCTGAGGTGGG - Intronic
1101828456 12:108239221-108239243 AGGTGCAAAGGGCCTGTGGTGGG - Intronic
1102022466 12:109693370-109693392 AGGTGCAAAGGCCCTGTGGTAGG + Intergenic
1102029817 12:109733768-109733790 AAGTGCAAAGGCCCTGGGGTGGG + Intronic
1102149236 12:110677354-110677376 GTGTGCAAAGGTCCTGTGGTTGG - Intronic
1102199553 12:111047978-111048000 CTGTGCAAAGGCCCTGAGGTGGG + Intronic
1102201835 12:111062837-111062859 ATGTGCGAAGGCCCTGGGGTGGG + Intronic
1102400831 12:112628267-112628289 AAGTGCAAAGGCCCTGAGGTTGG + Intronic
1102452592 12:113052993-113053015 ATGTGCAAAGGCCCAGAGGTGGG - Intergenic
1102459072 12:113089144-113089166 AAGTGCAAAGGCCCTGGGGTGGG + Intronic
1102462164 12:113106546-113106568 ATGTGCAAGGGCCCTGAGGTAGG - Intronic
1102477456 12:113197880-113197902 AGGTGCAAAGGCCCTGAGGTAGG + Intronic
1102528307 12:113527748-113527770 ATGTGCAAAGGCCCTGAGGTAGG - Intergenic
1102544343 12:113643779-113643801 AAGTGCAAAGGCCCTGGGGTAGG - Intergenic
1102587195 12:113931694-113931716 AGGTGCAAAGGCCCTGTGGTAGG - Intronic
1102622011 12:114203566-114203588 ATGTGCAAAGGCTCTGTGGCAGG - Intergenic
1102636787 12:114331567-114331589 ATGTGCAAAGGCCCTGAGGTGGG - Intergenic
1102648358 12:114418536-114418558 ATGTGCAAAGGCCCTGGGGTAGG - Intergenic
1102694501 12:114787614-114787636 AAGTGCAAGGGCCCTGAGGCTGG + Intergenic
1102810673 12:115821416-115821438 TTGTGCAAAGGCCCTGTGGTTGG + Intergenic
1102811340 12:115826855-115826877 ATGTGCAAAGGCCCTGGGGCGGG - Intergenic
1102923311 12:116808865-116808887 ATTTCCAACGGCCCAGTGCTGGG - Intronic
1102929033 12:116848631-116848653 ATGTGCAAAGGCCCTGAGGCTGG - Intronic
1103002198 12:117393691-117393713 ATATGCAAAGGCCCTGAGGTTGG + Intronic
1103019009 12:117518763-117518785 AGGTGCAAAGGCCCTGGGGTAGG - Intronic
1103041818 12:117702096-117702118 ATGTGCAAAGGCCCTGGAGTGGG - Intronic
1103042995 12:117711359-117711381 ATGTGCAAAGGCCCTGAGGCAGG + Intronic
1103043532 12:117715922-117715944 ATGTGCAAAGGCCCTGAGGCAGG - Intronic
1103197394 12:119056638-119056660 ATGTGCAAAGGCCCTGAGGTGGG - Intronic
1103361034 12:120353777-120353799 ATGTGCAAAGGCCCTGAGGTGGG - Intronic
1103414720 12:120736591-120736613 ATGTGCAGAGGCCCTGTGGTGGG + Intronic
1103443915 12:120981589-120981611 ACGTGCAAAGGCCCTGGGGTGGG - Intronic
1103697767 12:122830964-122830986 ATGTGCAAAGGCTCTGAGGTGGG + Intergenic
1103860703 12:124010895-124010917 ATGTACAAAGGCCCTGAGGCAGG + Intronic
1103938666 12:124490097-124490119 ATGTGCAAAGGTCCTGAGGTGGG - Intronic
1103994309 12:124819273-124819295 CTGTGCAAAGGCCCTGTGGTAGG + Intronic
1104085803 12:125473173-125473195 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
1104377735 12:128279617-128279639 ATGTGCAAAGGCCCTGCGGTGGG - Intronic
1104386508 12:128355741-128355763 ATGTGCAAAGGCCCTGAGGTGGG - Intronic
1104427199 12:128687563-128687585 ACGTGCAAAGGCCCTGTGGCAGG + Intronic
1104696332 12:130866856-130866878 AAGTGCAAAGGCCCTGTGGCAGG + Intergenic
1105211216 13:18258240-18258262 ATGTGCAAAGGACCTGAGGTAGG + Intergenic
1105781406 13:23707902-23707924 ATGTCCAAAGGCCCTGAGGTGGG - Intergenic
1106022433 13:25928190-25928212 ATGGCCAGGGGGCCTGTGTTAGG + Intronic
1106029886 13:25990503-25990525 ATATGCAAAGGCCCTGAGGTGGG + Intronic
1106230281 13:27816050-27816072 ATGTGCGAGGCCCCTGAGGTGGG - Intergenic
1106393626 13:29359493-29359515 AGGTCCAAGGGCATTTTGGTTGG + Intronic
1107870764 13:44744625-44744647 AGGTCTAAGGGCCATGTGATAGG - Intergenic
1108597065 13:51958606-51958628 AGGGCCAAGGGCCCTGGGGATGG + Intronic
1109628076 13:65004816-65004838 AAATGCAAAGGCCCTGTGGTGGG + Intergenic
1112803599 13:103138313-103138335 ATGTGCAAGGGTCCTGAGGCTGG + Intergenic
1114734830 14:25033572-25033594 ATGTGCAAAGGCCCTGAGGTAGG - Intronic
1114905865 14:27125433-27125455 TTGTCCAATGGTCCTGTGGGAGG - Intergenic
1115509788 14:34128347-34128369 ATTTCCCAGGGCCCTGTCCTGGG - Intronic
1116638504 14:47429983-47430005 ATGTGCAAAGTCCCTGAGGTGGG + Intronic
1116683158 14:48002950-48002972 GTGTGCAAGGACCCTGTGGTGGG + Intergenic
1117076147 14:52106732-52106754 GAGTCCTAGGGCACTGTGGTGGG + Intergenic
1117154952 14:52929611-52929633 ATGTACAAGGGCACTGCGGCAGG - Intronic
1118067503 14:62207780-62207802 ATGTCCCAGGGCTTTGTGGAAGG - Intergenic
1118480458 14:66159675-66159697 ATGTGCAAAGGCCCTGGGGTTGG + Intergenic
1118735245 14:68696433-68696455 ATGTTCAAAGGTCCTGCGGTGGG + Intronic
1118857057 14:69631794-69631816 ATTTCCCAGCGCCCTGTGTTAGG - Intronic
1119407921 14:74410353-74410375 GTGTGCAAAGGCCCCGTGGTTGG + Intronic
1119557586 14:75565549-75565571 ATGTGCAAAGGCTCTGAGGTAGG - Intergenic
1119644241 14:76337053-76337075 AAGTGCAAAGGCCCTGAGGTAGG + Intronic
1119729718 14:76943264-76943286 AAGTGCAAAGGCCCTGTGGCAGG - Intergenic
1119768367 14:77205103-77205125 ATATGCAAAGGCCCTGTGGCAGG + Intronic
1119890385 14:78178103-78178125 ATGTCCAAGGCCACTCAGGTAGG + Intergenic
1119895219 14:78214231-78214253 ATGGACAAAGGCCCTGTGGTAGG - Intergenic
1119993572 14:79227258-79227280 ATGCTCAAGGGCCCTGTTGGTGG + Intronic
1120927376 14:89811140-89811162 ATGTGCAAGGTCCTTGTGGCAGG + Intronic
1120962621 14:90139371-90139393 AGATGCAAAGGCCCTGTGGTGGG + Intronic
1121070494 14:91016001-91016023 AAGTCCAGGGGTGCTGTGGTGGG + Intronic
1121302814 14:92885483-92885505 ACGTGCAAAGGCCCTGTGGTAGG + Intergenic
1121490619 14:94356546-94356568 AAGTGCAAAGGCCCTGGGGTAGG - Intergenic
1122088720 14:99323916-99323938 GGGTCCAAGGGGCCTCTGGTGGG + Intergenic
1122151183 14:99726964-99726986 CTGTGCAAGGGCTCAGTGGTAGG - Exonic
1124581184 15:30956565-30956587 TAGTGCAAGGGCCCTGTGGCAGG + Intronic
1124651588 15:31478033-31478055 ATGTGCAAAGGCCCTGAGGCAGG + Exonic
1125544892 15:40495993-40496015 ATGTGCAGAGGCTCTGTGGTAGG - Intergenic
1126559250 15:50025456-50025478 ATGTGCAAAGGTCCTGTGGAGGG - Intronic
1127146290 15:56027504-56027526 AAGTGCAAAGGCCCTGAGGTGGG - Intergenic
1127354976 15:58189395-58189417 AGGTGCAAAGGCCCTGTGGCTGG - Intronic
1127381023 15:58430597-58430619 CTGTGCAAAGGCCCTGAGGTAGG - Intronic
1127661143 15:61101441-61101463 ATGTGCAAGGGCCCCGAGGTAGG + Intronic
1127735038 15:61831867-61831889 AGGTCCACTGGCCCTGGGGTGGG + Intergenic
1128255848 15:66196036-66196058 ATGTGCAAAGGCCCTGAGGCAGG + Intronic
1128614404 15:69098209-69098231 ATGTACAAAGGCCCTGAGGCTGG + Intergenic
1128650718 15:69410806-69410828 GCGTCTCAGGGCCCTGTGGTGGG + Intergenic
1129479413 15:75811122-75811144 ATGTGCAAAGGTCCTGAGGTAGG - Intergenic
1129556532 15:76516074-76516096 ATTGACAAAGGCCCTGTGGTTGG - Intronic
1129774690 15:78228799-78228821 ATGTGCAAAGGCCCCGAGGTGGG - Intronic
1129998047 15:80023752-80023774 ATGTGCAAAGGCCCTGAGGCAGG - Intergenic
1130059285 15:80558054-80558076 ATGTGCAAAGGCCCTGAGGTTGG - Intronic
1130312459 15:82767352-82767374 ATGTGCCAAGGCCCTGTGGCAGG + Intronic
1131260791 15:90886637-90886659 ATGTAGAAGGGCCCTGTGCTTGG - Intronic
1131380697 15:91961599-91961621 AAGTGCAAAGGCCCTGAGGTAGG - Intronic
1131410118 15:92200535-92200557 ATGTCCTAGGGCTTTGTGGAAGG + Intergenic
1131425666 15:92343750-92343772 TTGTCCAAGGGCCCTATTGCGGG + Intergenic
1131453641 15:92566274-92566296 ATGTCCTAGGGCTTTGTGGAAGG - Intergenic
1131507620 15:93031265-93031287 ATGTCCAAGCGCCCTGGTTTGGG + Intergenic
1131844218 15:96471640-96471662 AGGTCCAAAGGCCCTGGGGTAGG - Intergenic
1131931931 15:97452298-97452320 ATGTGCAAAGGCCCTGAGGCAGG + Intergenic
1132993259 16:2808364-2808386 ATGTGCCAGGGCCCTGAGGTGGG + Intergenic
1133267828 16:4595233-4595255 GGGTGCAAAGGCCCTGTGGTGGG + Intronic
1133372216 16:5253796-5253818 ATGTGCAAAGGCCCTGTGGCAGG - Intergenic
1133396130 16:5448981-5449003 ACGTGCAAAGGCCCTGTGGTGGG - Intergenic
1133460413 16:5982246-5982268 ATGTGCAAAGGCCCTATGGTGGG - Intergenic
1133540758 16:6751020-6751042 ATGTTCAAGGGCCCTGATGTGGG + Intronic
1133912373 16:10077748-10077770 ATATGCAAAGGCCCTGAGGTGGG - Intronic
1133928961 16:10216682-10216704 ATGTGCAAAGGCCCTGAGGAGGG + Intergenic
1134071041 16:11259965-11259987 CAGTGCAAAGGCCCTGTGGTGGG + Intronic
1134092770 16:11400263-11400285 CCGTGCAAAGGCCCTGTGGTGGG - Intronic
1134104468 16:11476075-11476097 AGGTGCAAAGGCCCTGGGGTAGG + Intronic
1134196667 16:12164178-12164200 ATATGCAAAGGCCCTGGGGTAGG + Intronic
1134308471 16:13054857-13054879 ATGTGCAAAGGCCCCGTGGCAGG - Intronic
1134505814 16:14806011-14806033 ATGTGCAAAGGCCCAGAGGTGGG - Intronic
1134559141 16:15192720-15192742 AAGTGCAAAGGCCCTGGGGTAGG - Intergenic
1134574766 16:15322928-15322950 ATGTGCAAAGGCCCAGAGGTGGG + Intergenic
1134665824 16:16017891-16017913 AAGTACAAGGGCCCTGGGGTGGG + Intronic
1134678886 16:16110037-16110059 ATGTGCAAAGGCCCTGAGGTAGG - Intronic
1134844310 16:17426958-17426980 AAGTGCAAGGGCCCTGAGGCAGG + Intronic
1134919677 16:18104333-18104355 AAGTGCAAAGGCCCTGGGGTAGG - Intergenic
1134939758 16:18278289-18278311 ATGTGCAAAGGCCCAGAGGTGGG + Intergenic
1135420826 16:22304585-22304607 ATGTGCAAAGGCCCAGGGGTAGG + Intronic
1135463461 16:22664849-22664871 ATGTGCAAGGGTCCTGGGGCAGG + Intergenic
1135640403 16:24115035-24115057 ATGTGCAAAGGCCCTGTGGTTGG + Intronic
1135641453 16:24123258-24123280 AGGTGCAAAGGCCCTGTGGTTGG + Intronic
1135830835 16:25771449-25771471 CTGTGCAAAGGCCCTGGGGTAGG - Intronic
1135938611 16:26801845-26801867 ATGTGCAAAGGCCCTGGGGCAGG - Intergenic
1136017101 16:27407487-27407509 ATGTCCAAAGGCCCTGATGCAGG + Intronic
1136066253 16:27760957-27760979 ACATTCAAAGGCCCTGTGGTTGG + Intronic
1136088975 16:27904706-27904728 ATGTGCAAAGGCCCTGGGGTGGG - Intronic
1136106385 16:28033152-28033174 AGGTGCAAAGGCCCTGGGGTAGG - Intronic
1136238562 16:28930370-28930392 AAGTGCAAGGGCCCTGAGGCAGG + Intronic
1136412989 16:30087694-30087716 ACGTGCAAAGGCCCTGAGGTGGG - Intronic
1136511673 16:30741688-30741710 AAGGCCAAGGGCTCTGTTGTTGG + Intronic
1138107502 16:54296710-54296732 AAGTGCAAAGGCCCTGTGGTAGG + Intergenic
1138240019 16:55419882-55419904 AAGTGCAAGGGCCCTGAGGCTGG - Intronic
1138245464 16:55463809-55463831 AAGTGCAAAGGCCCTGGGGTGGG - Intronic
1138335347 16:56248723-56248745 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
1138413827 16:56859836-56859858 ATGTGCAAAGGCCCTCTGGCAGG - Intergenic
1138457885 16:57131797-57131819 ATGTGCAAAGGCCCTGAGGTGGG - Intronic
1138512973 16:57519215-57519237 ATGTGCAAAGGCCCTGTGGTGGG - Intronic
1138805703 16:60086219-60086241 CAGTCCAAGGTCCCTGTGCTGGG - Intergenic
1139490446 16:67283213-67283235 ATGTGCAAAGGTCCTGTGGCAGG + Intronic
1139694237 16:68662217-68662239 GTGTGCAAAGGCCCTGTGGTAGG + Intronic
1140206305 16:72936581-72936603 AAGTGCAAAGGCCCTGTGGCAGG + Intronic
1140250499 16:73290426-73290448 CTGTGCAAAGGCCCTGGGGTGGG + Intergenic
1140526304 16:75625749-75625771 AAGTGCAAAAGCCCTGTGGTAGG - Intergenic
1140623299 16:76762759-76762781 ATGTCCTAGGGCTTTGTGGAAGG + Intergenic
1140732950 16:77872634-77872656 ATGTGCAAAGGCCTTATGGTGGG - Intronic
1140862024 16:79026286-79026308 ATGTGCAAAGGCCCTGTGGCAGG - Intronic
1141380881 16:83575571-83575593 ATGTGCAAAGGCCCTGGGATGGG - Intronic
1141478319 16:84288766-84288788 CTGTGCAAAGGCCCTGGGGTGGG + Intergenic
1141576935 16:84970101-84970123 ATGTGCAAAGGCCCTGGGGCAGG - Intergenic
1141687515 16:85578745-85578767 CTGTGCAAAGGCCCTGAGGTGGG - Intergenic
1141884014 16:86879467-86879489 CTGTGCAAAGGCCCTGTGGCAGG - Intergenic
1142143627 16:88483439-88483461 ATGTGCAAAGGCCCTGGGGCGGG - Intronic
1143327161 17:6106887-6106909 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
1143356127 17:6330189-6330211 TTGTGCAAAGGCCCTGTAGTGGG - Intergenic
1143450348 17:7032697-7032719 ATGCCCAAGGGCTTTGTGGAAGG - Intergenic
1143458498 17:7083686-7083708 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1143731140 17:8883534-8883556 ATGTGCAAAGGCCCTGTGGTGGG - Intronic
1144517134 17:15926513-15926535 ATGTCCAAAGGCCCTGTGGCAGG + Intergenic
1144743585 17:17598212-17598234 AGGTGCAAAGGCCCTGTGGCTGG - Intergenic
1144998685 17:19288554-19288576 CTGTGCAAAGGCCCTGAGGTGGG + Intronic
1145064233 17:19751158-19751180 ATGTGCAAAGGCCTTGTGGTAGG - Intergenic
1145239579 17:21232545-21232567 ATGTGCAAAGGCCCTGAGGCAGG + Intergenic
1145242247 17:21246857-21246879 ACGTGCAAAGGCCCTGGGGTAGG + Intronic
1145253161 17:21307485-21307507 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
1145262710 17:21364401-21364423 AAGTGCAAAGGCCCTGGGGTAGG + Intergenic
1145266399 17:21381533-21381555 ATGTGCAAAGGCCCTGAGGTAGG - Intronic
1145323410 17:21780433-21780455 AAGTGCAAAGGCCCTGAGGTGGG - Intergenic
1145764936 17:27452089-27452111 ATGTGCAAAGGCCCTGAGGTAGG - Intergenic
1145936153 17:28716029-28716051 ATCTCCAAGGTCATTGTGGTGGG - Exonic
1146272151 17:31491558-31491580 AACTGCAAGGGCCCTGAGGTGGG + Intronic
1146291081 17:31607744-31607766 AAATGCAAAGGCCCTGTGGTAGG + Intergenic
1146568435 17:33933137-33933159 ATGTGCAAAGGCCCTGTGATGGG - Intronic
1146627947 17:34448199-34448221 ATGTGCCAGGGCACTGTGCTAGG + Intergenic
1147312463 17:39603647-39603669 ATGTCCAGGGTCCCTCTGTTTGG + Intronic
1147320465 17:39642851-39642873 AGGTGCAAGGGCCCTGGGGTAGG + Intronic
1147444185 17:40464752-40464774 ACGTGCAAAGGCCCTGAGGTTGG - Intergenic
1147584109 17:41643192-41643214 TGGTCCAAGGGCCCTGAGGCTGG + Intergenic
1147718917 17:42526320-42526342 AAGTCCCAGAGCCCTGTGGTAGG + Intergenic
1148126186 17:45238334-45238356 AAGTGCAAAGGCCCTGGGGTGGG + Intronic
1148194891 17:45706231-45706253 ATGTGCAAAGGCCCTGAGGCAGG - Intergenic
1148787076 17:50150703-50150725 ATCTCCAAGCGCCCTGTGTGTGG + Intergenic
1149409412 17:56389899-56389921 GTGTACAAAGGTCCTGTGGTGGG - Intronic
1150739340 17:67766844-67766866 ATGTGCAAAGGACCTGTGGTAGG - Intergenic
1151440725 17:74127141-74127163 ATGTGCAAAGGCCCTGTGGCAGG - Intergenic
1151686203 17:75648154-75648176 ATGTGCAAAGGCCCTGTGGTGGG - Intronic
1151816869 17:76475455-76475477 ATGTGCAAAGGCCCTGGGGCTGG - Intronic
1152140457 17:78533432-78533454 ACGTGCAAAGGCCCCGTGGTGGG + Intronic
1152518313 17:80838934-80838956 ATTCCCAAGGGCCCTGTGCTGGG - Intronic
1152679199 17:81656933-81656955 AGGTGCAAAGGCCCTGGGGTGGG - Intronic
1152759852 17:82102101-82102123 ATGTCCAGGTGCCCAGTGGAGGG - Intronic
1152819026 17:82426336-82426358 ATGTTCCTGGGCCGTGTGGTCGG + Intronic
1153061601 18:1000825-1000847 ATGTGCAATGGTCCTGGGGTTGG + Intergenic
1153138065 18:1940782-1940804 ATGTCCTAGGGCTCTGTGGCAGG + Intergenic
1153971278 18:10229347-10229369 TTGTCCAAGAGCTCTGTGATGGG - Intergenic
1153984516 18:10340618-10340640 CTGTCCCAGGCCCCTGTGGTTGG - Intergenic
1155968080 18:32054649-32054671 CTGCCCAAGGGCTCTGTTGTAGG + Intronic
1156218889 18:35030899-35030921 AAGTGCAAAGGCCCTGAGGTAGG - Intronic
1156243923 18:35279487-35279509 ATCTGCAAGGGCCCTGTCTTAGG + Intronic
1158408061 18:57177977-57177999 ATGTGCAAGTGCCCTGAGGTAGG + Intergenic
1158477173 18:57790537-57790559 ATGTGCAAAGGCCCTGGGGTGGG - Intronic
1158765893 18:60449022-60449044 ATGTCCTAGGGATCTGTGGAGGG - Intergenic
1159228079 18:65566999-65567021 GTCTTCAAGGGCCTTGTGGTGGG - Intergenic
1159557250 18:69958261-69958283 ATGGTCAAGGGCCCTGTGCAAGG - Intronic
1159619934 18:70625335-70625357 ATTTCCCAGGGCATTGTGGTGGG + Intergenic
1160704998 19:525476-525498 ACGTCCAGGGGCCCTGAGGTGGG - Intergenic
1161098741 19:2409711-2409733 ATGTGCAAAGGCCCTGGGGTGGG + Intronic
1161213312 19:3079706-3079728 CTGTGCAAAGGCCCTGGGGTAGG + Intergenic
1161273379 19:3402793-3402815 ATGTGCAAAGGCCCTGAGGCAGG + Intronic
1161433748 19:4249640-4249662 GTGTGCAAAGGCCCTGGGGTAGG - Intronic
1161869124 19:6856952-6856974 AGGTGCAAAGGCCCTGAGGTGGG + Intronic
1161874138 19:6894522-6894544 ATGTGCAAAGGCCCTGTGGTAGG + Intronic
1161877745 19:6924963-6924985 ATATGCAAAGGCCCTGAGGTAGG - Intronic
1162064912 19:8119434-8119456 ATGTGCAAAGGCCCTGGGGTGGG - Intronic
1162101881 19:8343634-8343656 ATGTGCAGAGGCCCTGCGGTGGG - Intronic
1162105787 19:8368898-8368920 ATGTGCAAAGTCCCTGTGGCAGG + Intronic
1162152903 19:8658095-8658117 ATGTGCAAAGGCCCTGAGGCAGG + Intergenic
1162156370 19:8680860-8680882 CTGTGCAAAGGCCCTGAGGTGGG + Intergenic
1162293861 19:9799385-9799407 AAGTGCAAGGGCCCTGAGGCAGG - Intergenic
1162360712 19:10218539-10218561 AGGTGCAAAGGCCCTGGGGTGGG + Intronic
1162366954 19:10255526-10255548 GTGTGCAAAGGCCCTGTGGCAGG + Intronic
1162442175 19:10699725-10699747 AGGTGCAAAGGCCCTGAGGTTGG + Intergenic
1162466783 19:10846968-10846990 GTGTGCAAAGGCCCTGAGGTTGG + Intronic
1162489638 19:10984508-10984530 ATGGCCGTGGGCCCTGGGGTAGG - Intronic
1162491019 19:10991708-10991730 AGGTGCAAGGGCCCTGGGGCTGG + Intronic
1162554782 19:11380048-11380070 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
1162823921 19:13239311-13239333 ACATGCAAAGGCCCTGTGGTGGG - Intronic
1162845300 19:13387693-13387715 ATGTGCAAAGGCCCTGGGGCTGG + Intronic
1162856501 19:13472574-13472596 ATGTGCAAAGGCCCTGGGGAAGG - Intronic
1162858111 19:13484736-13484758 ATGTGCAAAGGTCCTGTGGAAGG - Intronic
1162947090 19:14050696-14050718 ACATGCAAAGGCCCTGTGGTAGG + Intronic
1163010989 19:14426040-14426062 CAGTGCAAGGGCCATGTGGTTGG + Intergenic
1163157453 19:15447255-15447277 CAGTGCAAAGGCCCTGTGGTGGG - Intronic
1163205838 19:15802133-15802155 ATGTGCAAAGGTCCTGAGGTAGG + Intergenic
1163253099 19:16138432-16138454 ACGGGCAAAGGCCCTGTGGTAGG - Intronic
1163345796 19:16741263-16741285 ATGTGCAAAGGCCCTGTGGCAGG - Intronic
1163425278 19:17237321-17237343 AAGTTCAAAGGCCCTGGGGTGGG - Intronic
1163484105 19:17576406-17576428 ATGTGCAAAGGCCCTGAGGTAGG + Intronic
1163549470 19:17957572-17957594 ATGTGCAAAGGTCCTGAGGTGGG + Intronic
1163576186 19:18112127-18112149 ATGTGCAAAGGTCCTGTGGCAGG + Intronic
1163627957 19:18401681-18401703 ATGTGCAAAGGCCCTGTGGTGGG + Intergenic
1163670873 19:18627750-18627772 ATGTGCAAAGGCCCTGGGGCTGG - Intergenic
1163695397 19:18761075-18761097 ATGTGCAGAGGCCCTGAGGTGGG - Intronic
1163704341 19:18803650-18803672 TTGTGCAAAGGCCCTGGGGTAGG + Intergenic
1163730805 19:18948219-18948241 ATGGGCAAAGGCCCTGAGGTGGG + Intergenic
1163748096 19:19059905-19059927 TTGTGCAAAGGCCCTGGGGTGGG - Intronic
1163766347 19:19165485-19165507 AGGTGCAAAGGCCCTGAGGTGGG + Intronic
1164700117 19:30279042-30279064 AAGTGCAAAGGCCCTGAGGTTGG - Intronic
1164892788 19:31839395-31839417 ATGTGCAAAGGCCCTGAGGCTGG + Intergenic
1165323888 19:35102868-35102890 CTGTGCAAAGGCCCTGAGGTGGG - Intergenic
1165475576 19:36028490-36028512 ACGTGCCAGGGCCCTGTGCTGGG - Intronic
1165735148 19:38171174-38171196 GTGTGCAAAGTCCCTGTGGTAGG + Intronic
1165784636 19:38453736-38453758 ATGTGCAAAGGCCATGAGGTGGG + Intronic
1165950587 19:39472222-39472244 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
1166500390 19:43336708-43336730 AAGTGCAAAGGCCCTGAGGTAGG + Intergenic
1166509788 19:43397303-43397325 AAGTGCAAAGGCCCTGAGGTAGG - Intergenic
1166650501 19:44570756-44570778 ATGTGCAAAGGCCCTGAGGCAGG + Intergenic
1166710615 19:44934859-44934881 AACTGCAAGGGCCCTGAGGTGGG - Intergenic
1166721333 19:44998205-44998227 ACGTGCAAAGGCCCTGTGGTAGG - Intergenic
1166929187 19:46291098-46291120 AAGTGCAAAGGCCCTGAGGTGGG - Intergenic
1167284029 19:48588825-48588847 AGGTGCAAAGGCCCTGAGGTGGG + Intronic
1167347790 19:48957098-48957120 AAGTGCAAAGGCCCTGAGGTAGG + Intronic
1167373878 19:49101089-49101111 AGGTCCAAGGGCCCGGGGGCAGG - Intronic
1167624764 19:50580214-50580236 AGGTGCCAAGGCCCTGTGGTAGG - Intergenic
1168306595 19:55439238-55439260 ATGTGCAAAGGCCCTGTGGCAGG - Intronic
1168311365 19:55462492-55462514 ACGTGCAAAGGCCCTGCGGTGGG - Intergenic
1168411656 19:56143967-56143989 AGGTGCAGAGGCCCTGTGGTGGG + Intronic
926219930 2:10928552-10928574 ATGTGCAAAAGCCCTGTGGCAGG - Intergenic
929598631 2:43191435-43191457 ATGTCCCAGGGCTCTCTGATGGG + Intergenic
929988934 2:46767903-46767925 ATGTGCAAAGGCCCTGAGGTGGG - Intergenic
930866176 2:56124036-56124058 CTTTCCAAAGGCCCTGTTGTGGG + Intergenic
931189177 2:59983047-59983069 AGGTCCATGGGCACTGTGGGTGG + Intergenic
931496442 2:62812673-62812695 ATGTCCAAGGGCTTTATGGAAGG + Intronic
931625087 2:64250216-64250238 TAGTGCAAAGGCCCTGTGGTAGG + Intergenic
931729983 2:65144738-65144760 ATGTGCAAAGGTCCTGTGGCAGG + Intergenic
932083781 2:68739305-68739327 ATGCCCAATGGCCCTGGCGTGGG + Intronic
932274820 2:70443879-70443901 AGGTCCAGAGCCCCTGTGGTGGG - Intergenic
932658196 2:73628305-73628327 ATGTCCTAGGGCTTTGTGGAAGG + Intergenic
932664827 2:73688352-73688374 ATGTCCTAGGGCTTTGTGGAAGG + Intergenic
933932940 2:87173063-87173085 AAGTCCAAGGGCCATGTGGTGGG - Intergenic
934712474 2:96525066-96525088 AGGTCCAAGAGCCCTCTGGAGGG - Intergenic
935121283 2:100185667-100185689 AAGTGCAAAGGCCCTGGGGTGGG + Intergenic
935785023 2:106541060-106541082 ATGTGCAAGGGCCCTGTGGTGGG + Intergenic
936360174 2:111792382-111792404 AAGTCCAAGGGCCATGTGGTGGG + Exonic
937478152 2:122233518-122233540 AAGTGCAAAGGCCCTGAGGTAGG + Intergenic
938768540 2:134480266-134480288 ATGTGCAAAGGCCCTGGGGTAGG - Intronic
938932779 2:136101253-136101275 ATGTGCAAAGGCCCTGGGGCAGG - Intergenic
939241873 2:139572037-139572059 ATGTCCTAGGGCTTTGTGGAAGG + Intergenic
939297431 2:140286405-140286427 ATGTCCAAGGGCTCTCTCATTGG - Intronic
939609598 2:144294275-144294297 ATGTGCAAAGGCCTTGTGGCAGG - Intronic
940383473 2:153043506-153043528 AAGTACAAAAGCCCTGTGGTAGG + Intergenic
941675462 2:168339263-168339285 TTTTGCAAGAGCCCTGTGGTAGG + Intergenic
942421121 2:175809020-175809042 ATGTGCAAAGGCCCTGTGGAAGG + Intergenic
942665330 2:178311221-178311243 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
942977362 2:182034426-182034448 ATGTACAAAAGCCCTGAGGTGGG + Intronic
944175852 2:196828759-196828781 ATGTCAAAAGGCTATGTGGTAGG + Intergenic
944605624 2:201349268-201349290 AAGTCCAAAGGCCCTGGGGTGGG - Intronic
945281648 2:208041022-208041044 ATATGCAAAGGCCCTGTGGCAGG - Intergenic
945396410 2:209324343-209324365 ATGTCCCAGACCCCTCTGGTAGG + Intergenic
947115631 2:226767477-226767499 ATGGCTAAGGGCCCTTTTGTTGG - Intronic
947187335 2:227467088-227467110 GTGTGCAAAGGCCCTGTGGTGGG + Intergenic
947592635 2:231394312-231394334 AGGTTCAAGGGCCCTTTGGAGGG - Intergenic
947666452 2:231908984-231909006 AAGTGCAAAGGCCCTGCGGTAGG + Intergenic
947929563 2:233952493-233952515 ATGTGCAAAGGTCCTGAGGTGGG + Intronic
947933693 2:233985165-233985187 ATGGGCAAAGGCCCCGTGGTGGG - Intronic
948058794 2:235028834-235028856 ATGTGCAAAGGCCCCGTGGTGGG + Intronic
948099306 2:235360681-235360703 TTGTCCAAGGGCCCTCAGCTTGG - Intergenic
948225448 2:236306125-236306147 CTGTCCAAGGGCTCTCTGGGAGG + Intergenic
948267393 2:236644983-236645005 TTGTCCAAGGCTCCTGTGGCTGG - Intergenic
948316644 2:237032273-237032295 ATGTGCAAAGGCCCTGAGCTGGG - Intergenic
948333888 2:237193046-237193068 CCGTGCAAGGGCCCTGAGGTAGG + Intergenic
948425253 2:237883198-237883220 CTGTCCCAGGGCCCTGGGCTGGG + Intronic
1168742294 20:202078-202100 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1168832347 20:853510-853532 ATGTGCAAAGGCCCTGTGGTGGG + Intronic
1168832405 20:853791-853813 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
1168851372 20:979262-979284 AAGTGCAAAGGTCCTGTGGTGGG - Intronic
1168857696 20:1020284-1020306 TTGTACAAAGGCCCAGTGGTAGG + Intergenic
1168908158 20:1423349-1423371 ATGTGCAAAGGCCCTGTGGTGGG + Intergenic
1168978289 20:1984198-1984220 AAGTGCAAAGGCCCTGAGGTAGG - Intronic
1169539326 20:6582104-6582126 CAGTGCAAAGGCCCTGTGGTAGG + Intergenic
1169621529 20:7512437-7512459 AGGCACAAAGGCCCTGTGGTGGG + Intergenic
1169645171 20:7802693-7802715 ATGTGCAAGGACCCTGTAGCAGG + Intergenic
1169861145 20:10153837-10153859 AAGTACAAGGGCCCTAAGGTGGG - Intergenic
1170580335 20:17694396-17694418 ATGTGCAAAGGCCCTGAGGCAGG + Intronic
1170846847 20:19969374-19969396 AGGTGCAAAGGCCCTGGGGTGGG - Intronic
1171154501 20:22859765-22859787 ATGTGCAAGGGCCCTGTGGTGGG - Intergenic
1171170860 20:23014300-23014322 GTGTGCAAAGGCCCTGGGGTAGG + Intergenic
1171749596 20:29035952-29035974 ATGGGAAAGGGCCATGTGGTGGG - Intergenic
1171987764 20:31672500-31672522 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
1172056417 20:32157641-32157663 CTGGCCAGGAGCCCTGTGGTGGG + Intronic
1172189708 20:33054575-33054597 ATGTGCAAAGGCCCTGGGGTGGG + Intergenic
1172739943 20:37158438-37158460 AGGATCAAGGGCCCTGTGGTTGG - Intronic
1172957158 20:38769140-38769162 ATGTACAAAGGCCCTGAGGCAGG - Intronic
1173178144 20:40780777-40780799 AAGTCCAAAGGCCCTGAGGCCGG + Intergenic
1173458069 20:43219702-43219724 ATGTGCAAGGGCCCTGGGGCAGG + Intergenic
1173758225 20:45537230-45537252 ATGTGCAAAGGCTCTGTGGCAGG - Exonic
1173802907 20:45905983-45906005 ATGAGCAAAGGCCCTGAGGTGGG + Intronic
1173846371 20:46191297-46191319 ACGTGCAAAGGCCCTGGGGTGGG + Intronic
1173850369 20:46214125-46214147 AGGTGCAAAGGCCCTGAGGTGGG + Intronic
1173902586 20:46601779-46601801 AGGTGCAAAGGCCCTGGGGTGGG + Intronic
1173919084 20:46730561-46730583 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
1173966414 20:47115931-47115953 GTGTGCAAAGGCCCTGTGGTGGG - Intronic
1173968136 20:47129461-47129483 ATGTGCAAAGGCCCTGAGGCAGG + Intronic
1174048141 20:47748253-47748275 ACGTGCAAGAGCCCTGTGGCAGG - Intronic
1174050475 20:47764058-47764080 AAGTTCAAGGGCCCTGGGGTGGG - Intronic
1174052005 20:47773434-47773456 AAGTGCAAAGGCCCTGGGGTGGG + Intronic
1174123791 20:48287931-48287953 TTGTGCAAAGGCCCTGGGGTAGG + Intergenic
1174170652 20:48616220-48616242 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1174189645 20:48731165-48731187 GTGTGCAAAGGCCCTGAGGTAGG - Intronic
1174200668 20:48804484-48804506 ATGTGCAAAGGCCCTGAGGCAGG + Intronic
1174202658 20:48818131-48818153 AGGTGCAAGGGCCCTGAGGCAGG + Intronic
1174280713 20:49437240-49437262 AAGTGCAAAGGCCCTGGGGTGGG + Intronic
1174293010 20:49522185-49522207 AAGTGCAAAGGCCCTGGGGTTGG - Intronic
1174302920 20:49595160-49595182 GTGTGCAAAGGCCCTGAGGTGGG - Intergenic
1174373556 20:50110843-50110865 TAGTGCAAAGGCCCTGTGGTGGG - Intronic
1174385370 20:50185653-50185675 AAGTGCAAAGGCCCTGAGGTAGG - Intergenic
1174410092 20:50329725-50329747 AAGTACAAGGGCCCTGAGGCAGG - Intergenic
1174428284 20:50448844-50448866 AAGTGCAAAGGCCCTGAGGTTGG - Intergenic
1174577683 20:51548187-51548209 AAGTACAAAGGCCCTGGGGTGGG - Intronic
1174614388 20:51824836-51824858 AACACCAAGGGCCCTGAGGTAGG + Intergenic
1174716312 20:52762521-52762543 ATTGCCAAGGGTCCTGTAGTGGG - Intergenic
1174808895 20:53628978-53629000 ATGTGCAAAGCCCCTGGGGTAGG + Intergenic
1174864127 20:54119236-54119258 TTGTCCAAGGTCACTTTGGTTGG + Intergenic
1175040040 20:56040349-56040371 AAGTGCAAAGGCCCTGAGGTAGG - Intergenic
1175110829 20:56646776-56646798 ATGTGCAAAGGCCCTGAGGTGGG + Intergenic
1175225139 20:57440186-57440208 GTGTGCAAAGGCCCTGGGGTAGG - Intergenic
1175261502 20:57677053-57677075 ATGTGCAAAGGCCTTGGGGTGGG - Intronic
1175272241 20:57742493-57742515 TTGTGCAAGGGCCCTGGGGGTGG + Intergenic
1175302341 20:57951747-57951769 ACGTGCAAAGGCCCTGTGGTGGG - Intergenic
1175314591 20:58038600-58038622 AGGTGCAAAGGCCCTGGGGTAGG - Intergenic
1175553661 20:59832768-59832790 ATGTGCAAAGGTCCTGAGGTGGG - Intronic
1175743347 20:61436005-61436027 ATGTGCAAAGGTCCTGTGGTGGG - Intronic
1175799232 20:61791810-61791832 AAGTGCAAAGGCCCTGGGGTAGG + Intronic
1176315640 21:5240048-5240070 ATGGGAAAGGGCCATGTGGTTGG + Intergenic
1176367879 21:6044691-6044713 GAGACCAAGGGCCCTGTGGACGG + Intergenic
1177773758 21:25545464-25545486 ATGTCCTAGGGATCTGTGGAAGG - Intergenic
1177861343 21:26458176-26458198 ATGTGCAAAGGCCCTGAGTTTGG + Intergenic
1177931095 21:27284824-27284846 CTGTGCAAAGGCCCTGTGATAGG - Intergenic
1179122932 21:38565566-38565588 ATGTGCAAAGGCCCTTTGGCAGG - Intronic
1179164513 21:38925138-38925160 ACGTGCAAAGGCCCTGGGGTAGG + Intergenic
1179437964 21:41375034-41375056 ATGTGCAAAGGTCCTGAGGTCGG - Intronic
1180303455 22:11055075-11055097 ATGCCCCAGGGCCCTCTGCTGGG - Intergenic
1180393435 22:12306001-12306023 ATGGGAAAGGGCCATGTGGTGGG + Intergenic
1180406313 22:12558767-12558789 ATGGGAAAGGGCCATGTGGTGGG - Intergenic
1180765020 22:18341197-18341219 ATGTGCAAAGGACCTGAGGTAGG - Intergenic
1180814009 22:18778487-18778509 ATGTGCAAAGGACCTGAGGTAGG + Intergenic
1180870841 22:19146421-19146443 ATGTGCAAAGGCCTAGTGGTGGG + Intergenic
1181200194 22:21212822-21212844 ATGTGCAAAGGACCTGAGGTAGG + Intronic
1181462116 22:23092037-23092059 ATGCCCAGAGGCACTGTGGTGGG + Intronic
1181689452 22:24550395-24550417 ATGTGCTAAGGCCCTGAGGTGGG + Intronic
1181701543 22:24624137-24624159 ATGTGCAAAGGACCTGAGGTAGG - Intronic
1181787038 22:25234884-25234906 ACGTGCAAAGGCCCTGTGGTGGG + Intergenic
1181819044 22:25461495-25461517 ACGTGCAAAGGCCCTGTGGTGGG + Intergenic
1181911685 22:26243468-26243490 ATGTGCAAAGGCCCTGAGGCAGG + Intronic
1181962184 22:26630174-26630196 ATGATCAAAGGCCCTGTGGTAGG + Intronic
1181972067 22:26698370-26698392 ATGTGCAAAGGCCCTGTGGTAGG - Intergenic
1182012391 22:27011738-27011760 ATGTTCAAAGGCCCTGAGGCAGG - Intergenic
1182015793 22:27038661-27038683 AGGTGCAAGGGTCCTGTGGCAGG + Intergenic
1182060373 22:27392947-27392969 AAGTGCAAAGGCCCTGTGATGGG - Intergenic
1182093922 22:27613818-27613840 ATGTGCAAAGGCCCTGTGGTGGG - Intergenic
1182112868 22:27735671-27735693 ATGTACAAAGCCCCTGTGGTGGG - Intergenic
1182128517 22:27833967-27833989 ACATGCAAAGGCCCTGTGGTGGG + Intergenic
1182280970 22:29217478-29217500 TTGTGCAAGGGCCCTGGGCTTGG + Intronic
1182332333 22:29560059-29560081 ACATGCAAAGGCCCTGTGGTGGG - Intronic
1182353611 22:29712343-29712365 AAGTGCAAGGGCCCTGGGGTGGG + Intergenic
1182465831 22:30515582-30515604 ATGTCCAAAGGCCTTGTGGTAGG - Intergenic
1182568893 22:31221283-31221305 ATGTGCAAAGGCCCTGGGGCAGG - Intronic
1182677921 22:32054586-32054608 ATGGCCAAAGGCCCTGATGTAGG + Intronic
1182983891 22:34698540-34698562 ATGTGCAAAGGTCCTGTGGTGGG - Intergenic
1183384105 22:37505117-37505139 ATGTGCAAAGGCCCTGAGGCAGG + Intronic
1183669548 22:39264455-39264477 AGGTGCAAAGGCCCTGTGGTGGG + Intergenic
1184088049 22:42277542-42277564 ATGGGCAAAGGCCCTGCGGTAGG + Intronic
1184098736 22:42330390-42330412 GTGTACAAAGGCCCTGAGGTGGG - Intronic
1184099085 22:42332277-42332299 AAGTGCAAAGGCCCTGAGGTAGG + Intronic
1184108245 22:42381112-42381134 AAGTCCATGGGCCCTCTGCTAGG + Exonic
1184360426 22:44014116-44014138 TTGTTCAAGGGTCCTGTGTTTGG + Intronic
1184382295 22:44152499-44152521 GTGTGCAAAGGCCCTGTGTTGGG - Intronic
1184421761 22:44386309-44386331 ATGTGCAAAGGCCCTGGAGTGGG - Intergenic
1184539093 22:45107874-45107896 AGGTGCAAAGGCCCTGGGGTGGG - Intergenic
1184901234 22:47447862-47447884 AGGTGCAAAGGCCCTGTGGTGGG + Intergenic
1203226643 22_KI270731v1_random:82102-82124 ATGTGCAAAGGACCTGAGGTAGG - Intergenic
1203264108 22_KI270734v1_random:4174-4196 ATGTGCAAAGGACCTGAGGTAGG + Intergenic
949382246 3:3459503-3459525 ATGTGCAAGGGCCCTGAGGCAGG + Intergenic
949391298 3:3565529-3565551 CTGTGCAAAGGCCCTGTGGCTGG - Intergenic
949879467 3:8650031-8650053 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
949909490 3:8889615-8889637 AAGTTCAAAGGCTCTGTGGTGGG + Intronic
949966234 3:9358860-9358882 AGGGCCAAGGGCCCTCTGATGGG - Intronic
950181869 3:10919040-10919062 ATGTGCAAAGGCCCTGAGGGAGG - Intronic
950499269 3:13353529-13353551 ATCTCCCAGGGCCCAGTGGTGGG - Intronic
950723312 3:14899916-14899938 AAGTACAAAGGCCCTGGGGTAGG + Intronic
950750653 3:15125380-15125402 ATGTGCAAAGGCCCTGTGGCAGG - Intergenic
950774267 3:15336212-15336234 ATGTGCAAAGGTCCTGAGGTGGG + Intronic
950873007 3:16245472-16245494 GGGGCCAAGGGCCCTGTGGCAGG - Intergenic
951188940 3:19746995-19747017 ATGTACAAAGGTCCTGAGGTGGG + Intergenic
951844591 3:27071904-27071926 AAGTCCAAAGGCCCTGAGGCAGG - Intergenic
952175169 3:30854101-30854123 ATGTATAAAGGCCCTGTGGCAGG - Intronic
952252844 3:31671384-31671406 ATGTGCAAAGGCCCTGGGGTAGG + Intronic
952276332 3:31880706-31880728 ATGTGCAAAGGTCCTGTGGCAGG - Intronic
953126220 3:40093994-40094016 ACGTGCAAAGGCCTTGTGGTAGG - Intronic
953673557 3:44982479-44982501 GGTTCCAAGAGCCCTGTGGTAGG - Intronic
953680062 3:45032312-45032334 ACATGCAAAGGCCCTGTGGTGGG - Intronic
953691145 3:45120763-45120785 ATGTGCAAAGGCCCTGAGGTGGG - Intronic
954383023 3:50229647-50229669 AAGTGCAAGGGCCCTGGGTTGGG - Intronic
954980015 3:54737449-54737471 ATGTGCAAAGGCCCTGTGACAGG + Intronic
955031898 3:55230225-55230247 ATGTGCAAAGGCCCTCTGGTGGG + Intergenic
955069161 3:55557769-55557791 ATGTGCAAAGGTCCTGTGGCTGG - Intronic
955202603 3:56864322-56864344 ATGTGCAAGGGCCCTGTGGCAGG - Intronic
955216986 3:56992341-56992363 ATGTACAAAGGTCCTATGGTAGG + Intronic
955516980 3:59735569-59735591 AAGTGCAAGGGCCCTGAGATGGG + Intergenic
955551266 3:60087633-60087655 ATGTCCTAGGGCTTTGTGGAAGG - Intronic
955940172 3:64139798-64139820 ATGTGTAAAGGCCCTGTGGTAGG - Intronic
956030313 3:65030202-65030224 CTGTGCAAAGGCCCTGTGGTAGG + Intergenic
956212125 3:66812932-66812954 CTGTGCAAAGGCCCTGTGGCAGG - Intergenic
956403072 3:68900413-68900435 ATGTGCAAAGACCCTGTGGCAGG - Intronic
956687587 3:71844571-71844593 ATGTACTAAGGCCCTGGGGTGGG - Intergenic
956802928 3:72779269-72779291 ATGTGCAAAGGCTCTGTGGCAGG - Intronic
956870767 3:73415284-73415306 ATGTGCAAAGGTCCTGTGGTAGG + Intronic
956990257 3:74754596-74754618 ATGTGCAAAGGCCCTGTGAAGGG - Intergenic
957070797 3:75566432-75566454 ATGTGCAAAGGCCCTGTGGCAGG + Intergenic
957631914 3:82727085-82727107 ATGTGCAAAGGCCCTGAGGCAGG + Intergenic
959717071 3:109444527-109444549 CTGTCCAAGGGCCTTGGGGGTGG + Intergenic
960203043 3:114861058-114861080 AGGTCTAAAGGCCCTGAGGTGGG - Intronic
960300497 3:115997604-115997626 AAGTGCAAAGGCCCTGAGGTTGG + Intronic
961283297 3:125780136-125780158 ATGTGCAAAGGCCCTGCGGCAGG - Intergenic
961365676 3:126397941-126397963 AGGCCCAAAGGCCCTGAGGTGGG + Intronic
961442158 3:126959575-126959597 ATGGTCAAGGGCCTTGGGGTGGG + Intronic
961557623 3:127707355-127707377 ATGGCCAAGGACGCTGTGGGAGG - Intronic
962408900 3:135124158-135124180 ATGTGCAAAGGCCCTGAGGTGGG - Intronic
962647083 3:137451038-137451060 ATGTGCAAAGGTCCTGAGGTGGG + Intergenic
962689553 3:137880295-137880317 ATGTCGAAGGGACCTGCAGTTGG + Intergenic
963035225 3:141019861-141019883 ATGTACAAGGGGCCTGGGGAGGG + Intergenic
963260298 3:143185621-143185643 AGGTACCAGAGCCCTGTGGTAGG + Intergenic
963645680 3:147911266-147911288 ATGTGCAAAGGTCCTGAGGTGGG - Intergenic
963997434 3:151726069-151726091 ATTTCCAAGGTCCATGTTGTAGG + Intergenic
965189958 3:165515231-165515253 AAGTCCAAGAGACCTGTTGTGGG + Intergenic
965688354 3:171328943-171328965 AAGTACAAAGGCCCTGAGGTGGG - Intronic
965788420 3:172361464-172361486 ATGTCCTAGGGCTTTGTGGAAGG - Intronic
965899123 3:173617055-173617077 ATGTGCAAGGGTCCTGAGGTAGG - Intronic
966528618 3:180947881-180947903 ATGACCAAGAGCCATGTGGGTGG + Exonic
966599792 3:181763777-181763799 AAGTGCAAAGGCTCTGTGGTAGG + Intergenic
966985654 3:185178046-185178068 AGGTGCAAAGGCCCTGGGGTGGG + Intergenic
967907033 3:194509963-194509985 AAGTGCAAAGGCCCTGAGGTGGG - Intergenic
968808469 4:2789530-2789552 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
969014406 4:4094097-4094119 ATATGCAAAGGCCCTGTGGCAGG + Intergenic
969213220 4:5703964-5703986 CCGTGCAAGGGCCCTGAGGTGGG + Intronic
969454043 4:7291096-7291118 ATGTGCAAAGGTCCTGAGGTGGG + Intronic
969528610 4:7717200-7717222 ATGTGCAAAGGCCCTAGGGTGGG - Intronic
969565188 4:7973162-7973184 ATGTGCAAAGGCCCTGGGGCAGG + Intronic
969612020 4:8232697-8232719 ATGTCACTGGGCCCTGTGGGTGG - Intronic
969663580 4:8544496-8544518 AAGTGCAAAGGTCCTGTGGTTGG + Intergenic
969739557 4:9014324-9014346 ATGTGCAAAGGCCCTGTGGCAGG - Intergenic
969798732 4:9545858-9545880 ATGTGCAAAGGCCCTGTGGCAGG - Intergenic
969912741 4:10460546-10460568 ATGTACAAAGGCCCTGAGGTGGG + Intergenic
970289254 4:14553533-14553555 ATGTGCAAAGGTCCTGTGGTTGG - Intergenic
970430375 4:15983574-15983596 ATGTGCATGGGCCCTAAGGTGGG + Intronic
970561496 4:17285918-17285940 ATGTGCAAAGGCCCTGAGGCAGG + Intergenic
970811436 4:20099114-20099136 ATGTCCAAAGGGCCTGAGCTGGG + Intergenic
970955490 4:21805838-21805860 ATATCCAAAGGCCCTGTGCTTGG + Intronic
971225131 4:24744849-24744871 ATATCCCAGCTCCCTGTGGTGGG + Intergenic
971261601 4:25062291-25062313 GTGTGCAAAGGCCCTGTGGTGGG + Intergenic
971354225 4:25879788-25879810 TCGTGCAAAGGCCCTGTGGTGGG - Intronic
971423094 4:26491638-26491660 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
972294463 4:37723271-37723293 ATGTTCAAAGGCCCTGTGGTAGG - Intergenic
972346949 4:38200242-38200264 ATCTGCAAGGGCCCTGAGCTGGG - Intergenic
972557557 4:40195992-40196014 ATGTGCAAAGGCCCTGAGGTGGG - Intronic
972997186 4:44895353-44895375 ATGTGCAATGGCCCTGAGGAGGG + Intergenic
974754425 4:66184994-66185016 ATGTCCTAGTGCTCTGTGGAGGG - Intergenic
976269197 4:83213787-83213809 ATGTGCAAAGGTCCTGAGGTGGG + Intergenic
976538351 4:86243578-86243600 ATGTTCAAGGGCCCAGAAGTGGG - Intronic
977439449 4:97043954-97043976 ATTTCCAAAGACCCTTTGGTTGG - Intergenic
978295177 4:107196508-107196530 ATGACCAAAGGTCCTGTGATAGG - Intronic
978446646 4:108786879-108786901 CAGTCCAAAGGCCCTGTGGGAGG - Intergenic
979252215 4:118577264-118577286 ATGTCCAAGGCCAATGGGGTGGG - Intergenic
980108054 4:128607425-128607447 ATGGGCAAAGGCTCTGTGGTAGG + Intergenic
981689730 4:147494484-147494506 AAGTGCAAAGGCCCTGTGGCAGG + Intronic
982134410 4:152259510-152259532 AGGTGCAAAGGCCCTGTGGCAGG - Intergenic
982162808 4:152586910-152586932 ATGTTCTAGGGCTCTGTGGAAGG + Intergenic
982210264 4:153029061-153029083 ATGTCCTAGGGATCTGTGGAAGG - Intergenic
982280177 4:153676292-153676314 ATGCCCAAGGGACCTGTGGAAGG + Intergenic
982768968 4:159378365-159378387 ATGCCCAAGCCCCCCGTGGTGGG + Intergenic
983971056 4:173874899-173874921 ATGTTCAAGGGCCCTGTGGCTGG + Intergenic
985431475 4:189885504-189885526 ATGGGAAAGGGCCATGTGGTGGG - Intergenic
985879689 5:2628810-2628832 ATGTGCAACGGCCCTGTAGCAGG - Intergenic
986346274 5:6838091-6838113 ACGTACCAAGGCCCTGTGGTGGG + Intergenic
987546720 5:19320072-19320094 ATCTGTAAGGGCTCTGTGGTTGG - Intergenic
988860208 5:35269517-35269539 ATTTAGAAGGGCCCTGTGCTTGG - Intergenic
990340981 5:54822700-54822722 AGGTCCAAGGACCCTGTCTTGGG + Intergenic
991600590 5:68348238-68348260 ATGTCCTAGGGCTCTGTGGAGGG + Intergenic
992066852 5:73117286-73117308 AGGTGCAAAGGCCCTGAGGTAGG - Intergenic
993692748 5:91022955-91022977 AAGTCCTAGGGCCTTGGGGTAGG + Intronic
994252720 5:97555787-97555809 ATGTGCAAAGGTCCTGTGGCAGG - Intergenic
997047943 5:130342364-130342386 ATGTGCAAAGCCTCTGTGGTAGG + Intergenic
997677680 5:135725428-135725450 ACGTGCAAAGGCCCTGAGGTGGG + Intergenic
997775232 5:136598187-136598209 ATGTTCAAGGCCACTGTGTTAGG - Intergenic
997791719 5:136767986-136768008 AGGTGCAAAGGCCCTGAGGTAGG + Intergenic
997838706 5:137218391-137218413 ATGTCCAAGAACCATGTGTTAGG - Intronic
998153816 5:139772589-139772611 AAGTGCAAAGGCCCTGTGCTGGG - Intergenic
998337690 5:141388005-141388027 ATGCCCAAGGGCTCCGTAGTGGG + Exonic
998338800 5:141398248-141398270 ATGCCCAAGGGCTCCGTAGTGGG + Exonic
998339927 5:141408323-141408345 CTGGCCAAGGGCTCGGTGGTGGG + Exonic
998341010 5:141417980-141418002 CTGGCCAAGGGCTCGGTGGTGGG + Exonic
998384128 5:141746577-141746599 TTGTGCAAAGGCCCTGTGGCAGG + Intergenic
998495572 5:142585647-142585669 ATGTGCCAAGGCCCTGTGGCAGG - Intergenic
998589845 5:143465275-143465297 ATGCCCAAGGGCTTTGTGGAAGG - Intergenic
998879593 5:146632810-146632832 ATGTGCAAAGGCCCTGAGGTGGG + Intronic
999233837 5:150078739-150078761 GGGTGCAAAGGCCCTGTGGTAGG - Intronic
999307021 5:150526082-150526104 AAGTGCAAAGGCCCTGAGGTAGG - Intronic
999326497 5:150647499-150647521 AAGTCCAAAGGCCCTGGGGCAGG + Intronic
999499558 5:152133034-152133056 CTGTCCTAGGGCCTTGTGGAAGG - Intergenic
1000022295 5:157328483-157328505 TTGTGCAAGGACCCTGCGGTGGG + Intronic
1000192517 5:158925060-158925082 ATGTGCAAAGGCCCTGAGATTGG - Intronic
1000382439 5:160641255-160641277 ATATGCAAAAGCCCTGTGGTAGG + Intronic
1000556469 5:162732491-162732513 ATGTGCAAGGGCCTTGTGCAAGG - Intergenic
1001092591 5:168752265-168752287 ATGTCCAAGGGCCCTGTGGTTGG - Intronic
1001197005 5:169682369-169682391 AGGTGCAAAGGCCCTGAGGTAGG + Intronic
1001286061 5:170424943-170424965 ATGTGCAAAGGCCCTTAGGTAGG - Intronic
1001400761 5:171445163-171445185 ATGTGCAAAAGCCCTGTGGTGGG + Intronic
1001422398 5:171597721-171597743 AGGTGCAAAGGCCCTGTGGTGGG - Intergenic
1001589917 5:172858200-172858222 ATGGGCAAAGGCCCTGAGGTGGG + Intronic
1001677548 5:173531160-173531182 ATGTTCAAAGGCCCTGAGGTGGG + Intergenic
1001905865 5:175472555-175472577 ATATGCAAAGGCCCTGTGGTAGG + Intergenic
1002207049 5:177570091-177570113 ATGTGCAAAGGCCCTGAGGTGGG - Intergenic
1002934971 6:1663695-1663717 CTGTGCAAAGGCCCTGTGGCAGG - Intronic
1003623202 6:7720515-7720537 AAGTGCAAAGGCCCTGTGGCAGG - Intergenic
1003634954 6:7823736-7823758 ATGTGCAAAGGTCCTGTGGCAGG + Intronic
1004882869 6:20025889-20025911 ATGTGCAAAGGCCCTGGGGTAGG - Intergenic
1005635735 6:27751648-27751670 ATGTAAAAAGGCCCTGTGGTGGG - Intergenic
1006262526 6:32887162-32887184 AGGTCCAAGGGCACTGAGGGAGG - Intergenic
1006430847 6:33994870-33994892 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1006440393 6:34050166-34050188 AAGTGCAAAGGCCCTGGGGTGGG - Intronic
1006457479 6:34140234-34140256 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
1006471328 6:34230790-34230812 AAGTGCAAAGGCCCTGTGGCGGG + Intergenic
1006797359 6:36740315-36740337 AGGCGCAAAGGCCCTGTGGTAGG - Intergenic
1006809974 6:36813727-36813749 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
1006929405 6:37678651-37678673 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
1007768174 6:44173403-44173425 AGGTGCAAAGGCCCTGAGGTGGG - Intronic
1008837252 6:55849517-55849539 AGGTGCAAAGGCCCTGTGGAAGG + Intronic
1009486184 6:64225263-64225285 ATGACCAGAGGTCCTGTGGTAGG + Intronic
1011169354 6:84488942-84488964 ATTTCCAAGGGGCCAGGGGTGGG - Intergenic
1011611939 6:89160876-89160898 ATGTGCAAGGGTCCTGTGACAGG + Intronic
1013114482 6:107091475-107091497 ATGTCCATGGGGCCTGTAGTGGG - Intronic
1013543024 6:111130670-111130692 AGGTCCAAGGCCCAGGTGGTGGG - Intronic
1015756065 6:136608084-136608106 CTGTGCAAAGGCCCTGTGATGGG + Intronic
1015793110 6:136983604-136983626 ATGTGGAAGGGCCCTGTGTTTGG + Intergenic
1016235386 6:141857627-141857649 ATGTGCAATGGCCTTGTGGAGGG + Intergenic
1016302284 6:142645871-142645893 ATGTGCAAAGGTCCTGTGGTGGG + Intergenic
1016662808 6:146600435-146600457 AAGTGCAAAGGCCCTGCGGTGGG - Intronic
1016808335 6:148235585-148235607 ATGTCCAGGAGCCCTATGGTTGG + Intergenic
1017043411 6:150325578-150325600 AAGTGCAAAGGCCCTGAGGTAGG + Intergenic
1017258405 6:152360337-152360359 AGGTCCTCGGGCCCTGTGGAGGG - Intronic
1017534329 6:155330350-155330372 ATGTGCAAAGGCCCTGGTGTAGG + Intergenic
1017913253 6:158813188-158813210 GTGTGCAAAGGCCCTGTGGTGGG - Intronic
1018840084 6:167510162-167510184 CTGTCTAAGGGGCCTGTGATTGG + Intergenic
1019389901 7:780225-780247 GTGCCCCAGGGCCCTGTGGCCGG - Intronic
1019493731 7:1326639-1326661 AGGCTCCAGGGCCCTGTGGTTGG - Intergenic
1019643823 7:2118606-2118628 ATGTCCAAGTTCCCTGGGGCAGG + Intronic
1019801385 7:3090878-3090900 ATTTGCAAAGGCCCTGTGGCAGG + Intergenic
1019949907 7:4362960-4362982 CTGTGCAAAGGCCCTGAGGTGGG - Intergenic
1020128736 7:5547708-5547730 AAGTGCAAAGGCCCTGTGGCAGG - Intronic
1020615193 7:10451313-10451335 ATGTCCAAGGGACCTGCAGTTGG + Intergenic
1020679081 7:11214652-11214674 AAGTGCAAAGGCCCTGTGGCAGG - Intergenic
1021657313 7:22884819-22884841 ATGGCCAAGAGCCATGGGGTAGG + Intergenic
1021766556 7:23955772-23955794 ATGTGCAAAGGCCCTGAGGCAGG + Intergenic
1021803603 7:24332935-24332957 ATGTGCAAAGGCCCTGGGGTGGG + Intergenic
1022534541 7:31087664-31087686 GTGATCAAAGGCCCTGTGGTTGG + Exonic
1022690764 7:32650531-32650553 ATGTGCAAAGGCCCTGAGGAAGG + Intergenic
1022806769 7:33830505-33830527 ACGTGCAAAGGCCCTGAGGTCGG + Intergenic
1022918330 7:34984365-34984387 ATGTGCAAAGGCCCTGAGGAAGG + Intronic
1023052748 7:36267434-36267456 ATGTGCAAAGGGCCTGTGGTGGG - Intronic
1023442672 7:40200530-40200552 ATGTGCAAAGGCTCCGTGGTAGG + Intronic
1024005494 7:45222437-45222459 CTGTGCAAAGGCCCTGGGGTTGG - Intergenic
1024114142 7:46176498-46176520 ATGGGCAAAGGCCCTGTGGCAGG + Intergenic
1024343812 7:48292637-48292659 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
1024485690 7:49916284-49916306 ATGACCCAGGCCCCTGTGGCTGG + Exonic
1025256292 7:57385772-57385794 AAGTGCAAAGGCCCTGAGGTGGG - Intergenic
1026132238 7:67630170-67630192 CTGTCCAAGGGCCTTATGGGTGG - Intergenic
1026910979 7:74091820-74091842 ATGTGCAAAGGCCTTGGGGTGGG + Intronic
1026938997 7:74275776-74275798 ATCTCCAGGGGGCCTGCGGTGGG + Intergenic
1027569350 7:79844152-79844174 CTGTGCAAAGGCCCTGTGGCAGG + Intergenic
1028233765 7:88335980-88336002 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1028850329 7:95530552-95530574 AGGTGCAAGGGTCCTGAGGTAGG + Intronic
1029073080 7:97915734-97915756 ATATGCAAAGGCCCTGTGGCAGG + Intergenic
1029275721 7:99403050-99403072 AAGTGCAAAGGTCCTGTGGTGGG - Intronic
1029356779 7:100057920-100057942 GTGCCCCAGGCCCCTGTGGTTGG + Intronic
1029633555 7:101768602-101768624 AGGTACAAGGGCCCTATAGTGGG - Intergenic
1030335719 7:108323933-108323955 AAATCCAAAGGCCCTGAGGTTGG + Intronic
1031970959 7:128064738-128064760 ATATTCAAGGGCCATGTTGTTGG + Intronic
1032702595 7:134395800-134395822 AAGTGCAAGGGCCCTGTGGTTGG + Intergenic
1032863605 7:135904503-135904525 AGGTGCAAAGGCCCTGAGGTGGG + Intergenic
1033048467 7:137983200-137983222 TTGTCATAGGGCCGTGTGGTTGG - Intronic
1034007631 7:147491323-147491345 ATGTGCAAATGTCCTGTGGTGGG - Intronic
1034075138 7:148224385-148224407 ATATTCAAAGGCCCTGAGGTAGG + Intronic
1034111761 7:148544098-148544120 AAGTCCCAGGGGCCTGAGGTGGG + Intergenic
1034124909 7:148662758-148662780 ATGTCCAAGGGCCCTGTGGTGGG + Intergenic
1034459944 7:151192628-151192650 ATGTGCAAGGCCCCAGTGGTTGG + Intronic
1034710456 7:153186458-153186480 ATGTCCTAGGGATCTGTGGAAGG - Intergenic
1036004275 8:4644248-4644270 ATGTTCAAAGGGCCTGGGGTGGG - Intronic
1036244601 8:7105545-7105567 ATGTGCAAAGGCCCCGTGGCAGG - Intergenic
1036361355 8:8079318-8079340 ATGTGCAAAGACCCTGTGGCAGG - Intergenic
1037638905 8:20724881-20724903 ATGGACAAAGGCCCTGAGGTAGG + Intergenic
1038332834 8:26623135-26623157 AGGTGCAAAGTCCCTGTGGTGGG + Intronic
1038754680 8:30329565-30329587 ATGTCCAAAGTTCCTGAGGTAGG + Intergenic
1038898108 8:31810525-31810547 CTGTGCAAAGGCCCTGAGGTGGG - Intronic
1038966201 8:32575287-32575309 ATGTTCAATTGCCTTGTGGTTGG + Intronic
1039719478 8:40147178-40147200 CTGTGCAAAGGCCCTGTGGTAGG - Intergenic
1040964556 8:53071230-53071252 ATGCCCAAGACCCTTGTGGTGGG - Intergenic
1041463712 8:58138498-58138520 AGCTCCAAGGGGCCTGTGTTGGG + Intronic
1041559348 8:59197144-59197166 ATGTGCAAAGGCCCTGGAGTGGG - Intergenic
1042426579 8:68656055-68656077 ATGTTGAAGGTCCCTGTGCTTGG + Intronic
1043615101 8:82115511-82115533 ATGTCCTAGGGCTTTGTGGAAGG - Intergenic
1043763821 8:84104187-84104209 ATGTTCAAAAGTCCTGTGGTGGG + Intergenic
1044387889 8:91611693-91611715 TTGTGCAAAGGCCCTGAGGTGGG + Intergenic
1044580751 8:93823638-93823660 ATGTGCAAAGGCCCTGATGTGGG + Intergenic
1044824326 8:96182153-96182175 AGGTGCAAAGGCCCTGGGGTGGG + Intergenic
1044951141 8:97436534-97436556 ATGTACAAGTGCCCTGAGGCAGG - Intergenic
1045219549 8:100185083-100185105 ATGTGCAAAGGCCCTGTGGTAGG - Intronic
1045370800 8:101520839-101520861 ATGTGCAAGGTCCCTGAGGCAGG - Intronic
1046081783 8:109378465-109378487 ATGTGCCAAGGCCCTGTGGTGGG - Intronic
1046395495 8:113633731-113633753 ATGCCTAGGGGCCCTGGGGTGGG - Intergenic
1046970966 8:120223065-120223087 ATGTGCTAAGGCCCTGAGGTGGG + Intronic
1047275164 8:123400287-123400309 AAGTGCAAAGGCCCTGAGGTAGG + Intronic
1047825135 8:128565133-128565155 ATGTGCAAAGGCCCTGGGGTTGG + Intergenic
1049235681 8:141511082-141511104 GTGTGCAAAGGCCCTGTGGCAGG - Intergenic
1049400714 8:142425746-142425768 CTGGCAAAGGGCCCTGGGGTTGG - Intergenic
1049475345 8:142794606-142794628 ATGTGCAAAGGCCCGGAGGTAGG - Intergenic
1050271502 9:3950517-3950539 ATGTGCAAATGCCCTGAGGTGGG - Intronic
1051114003 9:13673522-13673544 ATGTGCAAAGGCCCTGAGGCAGG + Intergenic
1051145543 9:14023483-14023505 AAGTGCAAAGGCCCTGTGGTAGG - Intergenic
1051681355 9:19611184-19611206 ATGTGTAAGGGCCCTGAGGCAGG + Intronic
1052023096 9:23546825-23546847 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1052046492 9:23799943-23799965 CTGTCCAAGGACTCTGTGGGTGG + Intronic
1053202230 9:36160586-36160608 ATGTGCAAGGGTTCTGAGGTGGG + Intronic
1053417835 9:37957899-37957921 AAGTTCAAGGGCCCTGGGGTGGG + Intronic
1053720645 9:40943549-40943571 ATGGGAAAGGGCCATGTGGTGGG - Intergenic
1054345342 9:63908606-63908628 ATGGGAAAGGGCCATGTGGTGGG + Intergenic
1055270050 9:74547646-74547668 CTGTGCAAAGGCCCTGAGGTAGG + Intronic
1055330065 9:75174423-75174445 ATGTCCAAGTGTCCTTTGGACGG - Intergenic
1057167518 9:92940611-92940633 CTGGCCAAGGGCCCAGTGGAGGG - Intergenic
1057293464 9:93821560-93821582 ATGTGCAAAGGCCCTGGGGTGGG - Intergenic
1058963657 9:110016311-110016333 ATTTCCAATGGGCCTGTCGTAGG + Intronic
1059485207 9:114621741-114621763 ATATGCAAAGGCCCTGGGGTGGG + Intronic
1059521401 9:114945733-114945755 AAGTACAAAGACCCTGTGGTTGG + Intergenic
1059671416 9:116495962-116495984 AGGTGCAAAAGCCCTGTGGTGGG - Intronic
1060290566 9:122299003-122299025 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
1060993253 9:127860980-127861002 AGGTGCAAAGGCCCTGGGGTGGG - Intergenic
1061045511 9:128162935-128162957 ATGTTCAAAGGGCCTGAGGTAGG + Intronic
1061236098 9:129343490-129343512 ATATGCAAAGGCCCTGTGGCTGG + Intergenic
1061516128 9:131091527-131091549 GTGTCCAGCGACCCTGTGGTGGG - Exonic
1061995212 9:134179757-134179779 ACGTGCAAAGGCCCTGGGGTGGG + Intergenic
1062288767 9:135785423-135785445 CTTTCCCAGGGCCCTGTGGGTGG - Intronic
1062426002 9:136506522-136506544 ATCTGCAAGTGCCCTGCGGTAGG - Exonic
1062639992 9:137514224-137514246 ATGTGCCCGGGCCCTGTGGCTGG + Intronic
1062640055 9:137514420-137514442 ATGTGCCGGGGCCCTGTGGCTGG + Intronic
1062640145 9:137514703-137514725 ATGTGCCCGGGCCCTGTGGCTGG + Intronic
1062640203 9:137514899-137514921 ATGTGCCCGGGCCCTGTGGCTGG + Intronic
1186328598 X:8508006-8508028 ATGTTCAGGGGCTGTGTGGTTGG - Intergenic
1186730255 X:12402357-12402379 AGGTCCAAAGCCCCTGAGGTGGG + Intronic
1187272165 X:17789156-17789178 CTTTCCATGGGCCCTGTGATTGG + Intergenic
1189088390 X:38051100-38051122 ATGTTCAAAGGCCCTGAAGTGGG + Intronic
1189327377 X:40121003-40121025 CAGTGCAAAGGCCCTGTGGTAGG + Intronic
1189351404 X:40278519-40278541 ATGTGCAAAGGCCCTGGGGTGGG + Intergenic
1190212052 X:48456807-48456829 AGGTGCAAGGGCCCCGAGGTAGG - Intergenic
1190827153 X:54028176-54028198 AAGTACAAAAGCCCTGTGGTGGG + Intronic
1191225469 X:58038272-58038294 ATGCCCAAGGGCTTTGTGGAAGG + Intergenic
1191798052 X:65044277-65044299 ATATGCAATGGCCCTGAGGTGGG + Intergenic
1192264081 X:69526796-69526818 ATGTGCCAAGGCCCTGAGGTGGG + Intronic
1194537912 X:95130181-95130203 GTGTAGAAGGGCACTGTGGTTGG - Intergenic
1194747358 X:97642597-97642619 ATGTGCAAATGCCCTGTGCTGGG - Intergenic
1195304154 X:103562652-103562674 ATGTGCAAAGGCCCTGAGGTGGG - Intergenic
1195479032 X:105321517-105321539 ATGTAAAAGGGCCCTGTGCTTGG - Intronic
1195751313 X:108163871-108163893 ATGTGCAAAGGCCCTGTGGTAGG + Intronic
1195953269 X:110301289-110301311 TTGCCAAAGGGCCCTGTGTTGGG + Intronic
1196208222 X:112965421-112965443 ATGGTCAAAGGCCCTGTGGCAGG - Intergenic
1196354691 X:114776753-114776775 ATGTCGAAGGGACCTGCAGTTGG - Intronic
1196823445 X:119722118-119722140 ATGTGCAAAGATCCTGTGGTAGG - Intergenic
1196824625 X:119731467-119731489 AGGTGCAAAGGCCCTGAGGTGGG + Intergenic
1196980249 X:121204992-121205014 ATGTCGAAGGGACCTGCAGTTGG - Intergenic
1198093363 X:133353778-133353800 ATGACCAAGGGCCCAGGAGTGGG + Intronic
1198425568 X:136516378-136516400 ATGTGCAAAGGTCCTGAGGTAGG - Intergenic
1198453846 X:136795697-136795719 AAGTGCAAAGGCCCTGAGGTTGG - Intergenic
1199719713 X:150534013-150534035 ATGTGCAAAGGCCCTGTGGTGGG + Intergenic
1199778291 X:151034819-151034841 ATGTGCAAAGGCCCTGAGGCAGG - Intergenic
1200317543 X:155149361-155149383 ATGTGCAAAGGCCCTGGGGAAGG - Intergenic
1202057286 Y:20848276-20848298 CTGTCCCAGGGAGCTGTGGTGGG + Intergenic