ID: 1034126044

View in Genome Browser
Species Human (GRCh38)
Location 7:148672362-148672384
Sequence CCCTTGGATTTCTCTCTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034126044_1034126047 12 Left 1034126044 7:148672362-148672384 CCTCAGAGAGAGAAATCCAAGGG No data
Right 1034126047 7:148672397-148672419 GAAGAAACCATACTGCCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034126044 Original CRISPR CCCTTGGATTTCTCTCTCTG AGG (reversed) Intergenic