ID: 1034126046

View in Genome Browser
Species Human (GRCh38)
Location 7:148672378-148672400
Sequence CTTCTTTGCTCACTTTCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034126046_1034126050 23 Left 1034126046 7:148672378-148672400 CCAAGGGAAAGTGAGCAAAGAAG No data
Right 1034126050 7:148672424-148672446 ATGTTCTCCCAAGTATCCCAAGG No data
1034126046_1034126047 -4 Left 1034126046 7:148672378-148672400 CCAAGGGAAAGTGAGCAAAGAAG No data
Right 1034126047 7:148672397-148672419 GAAGAAACCATACTGCCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034126046 Original CRISPR CTTCTTTGCTCACTTTCCCT TGG (reversed) Intergenic
No off target data available for this crispr