ID: 1034126047 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:148672397-148672419 |
| Sequence | GAAGAAACCATACTGCCTTT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1034126042_1034126047 | 13 | Left | 1034126042 | 7:148672361-148672383 | CCCTCAGAGAGAGAAATCCAAGG | No data | ||
| Right | 1034126047 | 7:148672397-148672419 | GAAGAAACCATACTGCCTTTTGG | No data | ||||
| 1034126044_1034126047 | 12 | Left | 1034126044 | 7:148672362-148672384 | CCTCAGAGAGAGAAATCCAAGGG | No data | ||
| Right | 1034126047 | 7:148672397-148672419 | GAAGAAACCATACTGCCTTTTGG | No data | ||||
| 1034126046_1034126047 | -4 | Left | 1034126046 | 7:148672378-148672400 | CCAAGGGAAAGTGAGCAAAGAAG | No data | ||
| Right | 1034126047 | 7:148672397-148672419 | GAAGAAACCATACTGCCTTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1034126047 | Original CRISPR | GAAGAAACCATACTGCCTTT TGG | Intergenic | ||