ID: 1034126047

View in Genome Browser
Species Human (GRCh38)
Location 7:148672397-148672419
Sequence GAAGAAACCATACTGCCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034126046_1034126047 -4 Left 1034126046 7:148672378-148672400 CCAAGGGAAAGTGAGCAAAGAAG No data
Right 1034126047 7:148672397-148672419 GAAGAAACCATACTGCCTTTTGG No data
1034126044_1034126047 12 Left 1034126044 7:148672362-148672384 CCTCAGAGAGAGAAATCCAAGGG No data
Right 1034126047 7:148672397-148672419 GAAGAAACCATACTGCCTTTTGG No data
1034126042_1034126047 13 Left 1034126042 7:148672361-148672383 CCCTCAGAGAGAGAAATCCAAGG No data
Right 1034126047 7:148672397-148672419 GAAGAAACCATACTGCCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034126047 Original CRISPR GAAGAAACCATACTGCCTTT TGG Intergenic
No off target data available for this crispr