ID: 1034126286

View in Genome Browser
Species Human (GRCh38)
Location 7:148674826-148674848
Sequence AGGGAGAGCACAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034126275_1034126286 26 Left 1034126275 7:148674777-148674799 CCTGGCAGTGGCCACAGGGCATG No data
Right 1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG No data
1034126272_1034126286 29 Left 1034126272 7:148674774-148674796 CCCCCTGGCAGTGGCCACAGGGC No data
Right 1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG No data
1034126277_1034126286 15 Left 1034126277 7:148674788-148674810 CCACAGGGCATGGAGACACAATC No data
Right 1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG No data
1034126284_1034126286 -7 Left 1034126284 7:148674810-148674832 CCTCTGTGTTTGGGGGAGGGAGA No data
Right 1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG No data
1034126273_1034126286 28 Left 1034126273 7:148674775-148674797 CCCCTGGCAGTGGCCACAGGGCA No data
Right 1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG No data
1034126274_1034126286 27 Left 1034126274 7:148674776-148674798 CCCTGGCAGTGGCCACAGGGCAT No data
Right 1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034126286 Original CRISPR AGGGAGAGCACAGTGATTGT GGG Intergenic