ID: 1034129283

View in Genome Browser
Species Human (GRCh38)
Location 7:148699817-148699839
Sequence GCGCGCGCTCCCGTTGGGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 46}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034129283_1034129294 17 Left 1034129283 7:148699817-148699839 CCGGTCCCAACGGGAGCGCGCGC 0: 1
1: 0
2: 1
3: 3
4: 46
Right 1034129294 7:148699857-148699879 CCGTGCGCCCGCCAGGCCGCTGG No data
1034129283_1034129295 18 Left 1034129283 7:148699817-148699839 CCGGTCCCAACGGGAGCGCGCGC 0: 1
1: 0
2: 1
3: 3
4: 46
Right 1034129295 7:148699858-148699880 CGTGCGCCCGCCAGGCCGCTGGG No data
1034129283_1034129287 -9 Left 1034129283 7:148699817-148699839 CCGGTCCCAACGGGAGCGCGCGC 0: 1
1: 0
2: 1
3: 3
4: 46
Right 1034129287 7:148699831-148699853 AGCGCGCGCCCTGACCCTGAGGG No data
1034129283_1034129300 26 Left 1034129283 7:148699817-148699839 CCGGTCCCAACGGGAGCGCGCGC 0: 1
1: 0
2: 1
3: 3
4: 46
Right 1034129300 7:148699866-148699888 CGCCAGGCCGCTGGGACTTGGGG 0: 1
1: 0
2: 1
3: 18
4: 147
1034129283_1034129292 10 Left 1034129283 7:148699817-148699839 CCGGTCCCAACGGGAGCGCGCGC 0: 1
1: 0
2: 1
3: 3
4: 46
Right 1034129292 7:148699850-148699872 AGGGTAGCCGTGCGCCCGCCAGG 0: 1
1: 0
2: 0
3: 1
4: 44
1034129283_1034129299 25 Left 1034129283 7:148699817-148699839 CCGGTCCCAACGGGAGCGCGCGC 0: 1
1: 0
2: 1
3: 3
4: 46
Right 1034129299 7:148699865-148699887 CCGCCAGGCCGCTGGGACTTGGG 0: 1
1: 0
2: 0
3: 7
4: 146
1034129283_1034129286 -10 Left 1034129283 7:148699817-148699839 CCGGTCCCAACGGGAGCGCGCGC 0: 1
1: 0
2: 1
3: 3
4: 46
Right 1034129286 7:148699830-148699852 GAGCGCGCGCCCTGACCCTGAGG 0: 1
1: 0
2: 0
3: 8
4: 129
1034129283_1034129297 24 Left 1034129283 7:148699817-148699839 CCGGTCCCAACGGGAGCGCGCGC 0: 1
1: 0
2: 1
3: 3
4: 46
Right 1034129297 7:148699864-148699886 CCCGCCAGGCCGCTGGGACTTGG 0: 1
1: 0
2: 0
3: 18
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034129283 Original CRISPR GCGCGCGCTCCCGTTGGGAC CGG (reversed) Intronic
900314468 1:2050188-2050210 GCGCGCGGTCCCATTGGCGCAGG + Intergenic
900534700 1:3171043-3171065 GTGCGGGGTCCCGCTGGGACAGG - Intronic
900988351 1:6086224-6086246 GCGGGGGCTCCCCTTGGCACTGG - Intronic
903164275 1:21509721-21509743 GCGCGCGCTCTGGGCGGGACAGG + Intronic
905390808 1:37634478-37634500 GCGGGCCCTCCCGTCGGGGCTGG - Intronic
907526480 1:55056869-55056891 GCGCGCGCGCGCGTTGGGGGTGG + Intronic
1067474378 10:46556461-46556483 CCGCGCGCTCCCGTTGGGGCGGG - Intergenic
1068620481 10:59176585-59176607 GCGCGCGCTCCCGGCGGGGAGGG - Exonic
1069430878 10:68332700-68332722 GGGCGCGCTCCCGATGGAAATGG + Intronic
1076705989 10:132301854-132301876 GCCCGGGCTCCCGATGGGCCTGG - Intronic
1089273330 11:117316063-117316085 GCGCGGGCTCCCGGCGGGGCTGG + Exonic
1089557230 11:119321170-119321192 GCGCGGGCTCGCGCTGGGTCGGG - Intronic
1092204695 12:6607586-6607608 GCGCGCGCGCCCGCTGCGAAGGG - Intergenic
1092286031 12:7129815-7129837 GCGCACGCACCTGTCGGGACCGG - Intronic
1097195179 12:57239087-57239109 GCCCGGGATCCCGCTGGGACTGG + Intronic
1104008699 12:124914157-124914179 GCGCGCGCTCCCAAAGGTACGGG + Exonic
1113994782 14:16056810-16056832 CCGCCCGCTCCCGTTGGGGCTGG + Intergenic
1123048529 14:105529881-105529903 GGGCGGGCTCCCCTAGGGACAGG + Exonic
1132163990 15:99566515-99566537 GGGCGCGCACCCCTTGGGGCCGG + Intronic
1136913547 16:34162292-34162314 CCGCCGGCTCCCGTTGGGGCCGG + Intergenic
1137531725 16:49282299-49282321 GTGGGCGCGCCCGTTGGGAGGGG + Intergenic
1139754656 16:69132624-69132646 GCGCGCGCGCACGTGGGGCCGGG + Exonic
1141658954 16:85431285-85431307 GAGCGAGCTCCCGTATGGACAGG - Intergenic
1142742050 17:1937015-1937037 GCGCGCGCTCCCTGTGGGAATGG - Exonic
1149454991 17:56780530-56780552 GCGCGTGCTTGCGTTGGGGCGGG - Intergenic
1151154747 17:72116803-72116825 GAGCGCTGTCCCTTTGGGACTGG + Intergenic
1159241702 18:65750816-65750838 CCGCGCGCTCCCGCTGGCTCCGG + Intronic
1161084550 19:2328788-2328810 GCCCGCGGTGCCGTCGGGACCGG - Intronic
927692227 2:25216204-25216226 GCGCGCGCATGCGTTGGGGCGGG + Intergenic
929151145 2:38750506-38750528 CCGCGCGCTCCCGGTGCGCCCGG - Intronic
932822751 2:74915444-74915466 GCACATGCTCCCGTTGGAACAGG - Intergenic
933139780 2:78779042-78779064 GCGCGAGCTCCCGGTGGGCGCGG + Intergenic
947518664 2:230828224-230828246 GCGCGCGCTCCTGGAGGTACGGG + Intergenic
947754324 2:232550795-232550817 GCGCCCGCCCCCGCTGGGGCTGG + Intronic
1169405084 20:5315894-5315916 GCGCGCGCCCGGGCTGGGACAGG + Intergenic
1171810516 20:29742299-29742321 CCGCCGGCTCCCGTTGGGGCCGG - Intergenic
1172404451 20:34677176-34677198 GCGCGCGCTGCCGCTGGCGCCGG + Intergenic
1172662113 20:36574660-36574682 GCCCGCCATCCCGGTGGGACGGG - Intronic
1175841311 20:62029463-62029485 GCGCGCGCGCACGTGGGCACTGG - Intronic
1176178521 20:63739484-63739506 GCGAGCGCGCCCGTGGGGAACGG + Intronic
1180312310 22:11250599-11250621 CCGCCCGCTCCCGTTGGGGCTGG - Intergenic
995354606 5:111224032-111224054 ACGCGCCCTCCCGCGGGGACCGG - Intronic
1000318878 5:160118648-160118670 GCGCGCGCTCCGAGTGGGGCAGG - Intronic
1011633993 6:89353155-89353177 GCGCGCGGTCCCGCAGGGTCTGG + Intergenic
1034129283 7:148699817-148699839 GCGCGCGCTCCCGTTGGGACCGG - Intronic
1035207033 7:157300475-157300497 ACGCGTCCTCCCCTTGGGACAGG - Intergenic
1040864218 8:52032025-52032047 GCTCAGGCTCCCGTTGGCACTGG + Intergenic
1045653909 8:104367500-104367522 GAGCGCGCTCCGGGTGGGAGAGG + Intronic
1047423563 8:124727075-124727097 GCGCGCGCGCGCGTGGGGGCGGG - Intronic
1052987989 9:34501963-34501985 GGGCCCTCTCCCGTTGGGAAGGG - Intronic
1055321621 9:75088287-75088309 GCGCGCGCTCCCGATAGGGAAGG - Intergenic