ID: 1034129726

View in Genome Browser
Species Human (GRCh38)
Location 7:148703923-148703945
Sequence ATCGCCATGCTGTTACTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 72}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034129726_1034129731 28 Left 1034129726 7:148703923-148703945 CCAAAAAGTAACAGCATGGCGAT 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1034129731 7:148703974-148703996 ACCAAGCACGGGAACTGTAAAGG 0: 1
1: 0
2: 0
3: 5
4: 57
1034129726_1034129730 17 Left 1034129726 7:148703923-148703945 CCAAAAAGTAACAGCATGGCGAT 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1034129730 7:148703963-148703985 CTAGATATAACACCAAGCACGGG No data
1034129726_1034129729 16 Left 1034129726 7:148703923-148703945 CCAAAAAGTAACAGCATGGCGAT 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1034129729 7:148703962-148703984 CCTAGATATAACACCAAGCACGG 0: 1
1: 0
2: 1
3: 5
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034129726 Original CRISPR ATCGCCATGCTGTTACTTTT TGG (reversed) Intronic
903548040 1:24139080-24139102 ATGGGCATGCAGTTTCTTTTTGG - Intronic
904175112 1:28622118-28622140 ATCGAGATCCTGTTTCTTTTTGG + Exonic
905600882 1:39249671-39249693 TTCGCCATGCTATTACATTTTGG + Intronic
910939703 1:92520067-92520089 ATAGGCATGCAGTTTCTTTTGGG + Intronic
911767114 1:101690703-101690725 ATCTCCATGCTCTAAGTTTTAGG + Intergenic
915673771 1:157512332-157512354 ATCTCTGAGCTGTTACTTTTAGG - Intergenic
918649838 1:186948369-186948391 ATTGCCTTGCAGTTACTCTTAGG - Intronic
921331395 1:214041598-214041620 TTTGCCATTCTGTGACTTTTGGG - Intergenic
922125865 1:222722746-222722768 ATAGTCATGCTTTTACTTTATGG - Intronic
1065296930 10:24284889-24284911 TTCGCCAACTTGTTACTTTTTGG + Intronic
1068165848 10:53331737-53331759 ATCTACTTGATGTTACTTTTTGG - Intergenic
1076525995 10:131112692-131112714 ATTGCCATACTGTTTCTTTAGGG - Intronic
1083511158 11:63210495-63210517 ATCTCCATCCTTTTCCTTTTCGG - Intronic
1086427869 11:86704545-86704567 ATCGCTATGTTGTTACTGTTGGG - Intergenic
1088580662 11:111312596-111312618 ATCTCCATACTGTCACTTGTAGG - Intergenic
1090413462 11:126524895-126524917 ATTGCCATGATGCTATTTTTGGG + Intronic
1094674034 12:32600481-32600503 ATTGCCATTCTGTTACATGTAGG - Intronic
1097914974 12:65011792-65011814 ATCTCCCTACTGTTACTTTGTGG + Intergenic
1099152766 12:79135735-79135757 AACTCCATGCCTTTACTTTTAGG + Intronic
1106017720 13:25884987-25885009 ATGGCCTTCCTGTTACTTTGTGG + Intronic
1109636549 13:65125424-65125446 CTTGACATTCTGTTACTTTTTGG - Intergenic
1112787064 13:102962690-102962712 ATAGCCATGCTATTAATATTTGG - Intergenic
1113009867 13:105751637-105751659 ATTTCCCTGCTGTTACTGTTGGG + Intergenic
1117868744 14:60175851-60175873 ATCCCCATGGTCTTACTGTTGGG - Intergenic
1125096088 15:35853675-35853697 AACTCCAGGCTGTAACTTTTTGG + Intergenic
1130087781 15:80792664-80792686 ATGGCCATGCTGTGACTTTGGGG + Intronic
1130150314 15:81306664-81306686 ATAGGCATGCTGGTCCTTTTAGG + Intronic
1133658543 16:7891301-7891323 AGCACCATGCTTTTACTTTGGGG + Intergenic
1138578437 16:57923609-57923631 ATACCAATGCTGTTACCTTTAGG - Intronic
1140887234 16:79255488-79255510 ATCTCCATGCTTTTATATTTAGG + Intergenic
1150351345 17:64447193-64447215 ATCAGCATCCTGTCACTTTTTGG - Intergenic
1150903102 17:69304703-69304725 ATCACAATGCTGCTACTTTGAGG + Exonic
1151059500 17:71075141-71075163 CTCGGCATGCTGTTACGATTTGG + Intergenic
1163992165 19:21008736-21008758 CTGGCCATGCTGTTATTTGTTGG - Intergenic
927727231 2:25435367-25435389 ATGGGTATGCTGTTTCTTTTTGG - Intronic
932533396 2:72563722-72563744 AACGCCAGGATGTGACTTTTAGG + Intronic
934522590 2:95028915-95028937 ATCGCTATGTGGTTTCTTTTTGG + Intronic
939901959 2:147861289-147861311 ATGGCCATGCTGTTTTGTTTAGG + Intronic
941263504 2:163328329-163328351 ATCTCCTTTCTGGTACTTTTAGG + Intergenic
943235407 2:185312373-185312395 ATAGCAATGCTGTTATTTTAGGG - Intergenic
1172611797 20:36257991-36258013 ATCGCAATGCTGTCACTTACAGG - Intronic
1172696170 20:36824530-36824552 ATAGGCATGAGGTTACTTTTTGG + Intronic
1174306681 20:49618390-49618412 ACCTCCTTGCTGTTTCTTTTTGG + Intergenic
1177185184 21:17785788-17785810 CTCTCGATGCTGTTGCTTTTGGG + Intergenic
1178148904 21:29771471-29771493 ATCTCCATGCTCTTGCATTTAGG + Intronic
1181478535 22:23182870-23182892 ATCTCCATGCAGTTGATTTTCGG - Intronic
949202664 3:1397860-1397882 AACCCCATGCTGTTACTTAGAGG + Intronic
955055057 3:55447281-55447303 ATCGACATGCTTTCACTCTTGGG + Intergenic
957090406 3:75724197-75724219 CTGGCCACGCTGTTATTTTTTGG - Intronic
957174109 3:76782898-76782920 ATTGCCATTTTGTTAGTTTTGGG + Intronic
960775478 3:121246945-121246967 ATTGCCATGAGGTAACTTTTTGG + Intronic
965847517 3:172981516-172981538 ATGGCCATACTGTTGCTTCTGGG + Intronic
968197167 3:196716428-196716450 TTAGCCATCCTGTTCCTTTTTGG + Intronic
970203058 4:13628322-13628344 ATCGACAGGCTTTTATTTTTAGG + Intergenic
975358414 4:73436078-73436100 ACCGCTATGCTGTTAATTATTGG + Intronic
982806413 4:159770649-159770671 ATCGTCATGCTGGAACTTTTTGG + Intergenic
984004034 4:174286741-174286763 AATTCCATGCTATTACTTTTGGG + Intronic
993584235 5:89703096-89703118 CTGGCCATACTGTTATTTTTAGG + Intergenic
993961241 5:94298777-94298799 ATCCCACTGCTGCTACTTTTTGG - Intronic
998816731 5:146022029-146022051 ATCCCTATCCTGTTATTTTTTGG + Intronic
1003788418 6:9514360-9514382 ACCATCATGCTGTTACTTGTTGG - Intergenic
1010056714 6:71574557-71574579 ATAGCTATGCTGTTAATATTTGG + Intergenic
1013497616 6:110714053-110714075 ATGGATATGCTGTTTCTTTTTGG - Intronic
1017395073 6:153989302-153989324 ATCGTCATGATTTTTCTTTTTGG + Intergenic
1021522488 7:21551636-21551658 ATGGCCATGCTGTCATTTATGGG - Intronic
1027741142 7:82007310-82007332 ATCGCCATGCTTTTGGTCTTTGG + Intronic
1034129726 7:148703923-148703945 ATCGCCATGCTGTTACTTTTTGG - Intronic
1042346779 8:67735826-67735848 ATGAGCATGCTGTTACCTTTGGG + Intronic
1044512165 8:93094910-93094932 AAAGCCATGATGTCACTTTTTGG + Intergenic
1047184753 8:122622805-122622827 GTCTTCATGCTGTTCCTTTTTGG + Intergenic
1047433336 8:124812521-124812543 ATCACCAGCATGTTACTTTTTGG + Intergenic
1050843836 9:10189241-10189263 ATTGCCCTGCTGCCACTTTTAGG + Intronic
1056777855 9:89526783-89526805 ATCGCCATGATATTCCTTTTGGG + Intergenic
1059181668 9:112220083-112220105 ATCGTCACGCTGTCTCTTTTTGG + Exonic
1188824610 X:34815821-34815843 ATTGCCATGCTGTGTCTCTTTGG - Intergenic
1196235104 X:113270632-113270654 AAAGCCATGCTTTTACTTTATGG + Intergenic
1196875091 X:120149415-120149437 ATCTCCATCCTTTTCCTTTTCGG - Intergenic
1197646742 X:129026236-129026258 ATTGCAATGCTGTTACTGATTGG - Intergenic