ID: 1034130696

View in Genome Browser
Species Human (GRCh38)
Location 7:148714013-148714035
Sequence AAATATACACACATGCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 585
Summary {0: 1, 1: 2, 2: 8, 3: 33, 4: 541}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034130696_1034130697 -9 Left 1034130696 7:148714013-148714035 CCTGGCTGCATGTGTGTATATTT 0: 1
1: 2
2: 8
3: 33
4: 541
Right 1034130697 7:148714027-148714049 TGTATATTTATATAATTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034130696 Original CRISPR AAATATACACACATGCAGCC AGG (reversed) Intronic
900098449 1:950415-950437 ACAGGTACACACATGCAGACAGG + Intronic
900372583 1:2338708-2338730 ACATATATCCACATGGAGCCTGG + Intronic
900464531 1:2818612-2818634 ACATATGCACACATGCAGAGAGG - Intergenic
900522867 1:3114668-3114690 ACACATGCACACATGCACCCGGG + Intronic
902058915 1:13625190-13625212 AAATAAAGACACCTGCATCCTGG - Intergenic
902238263 1:15071617-15071639 AAATATGCAAATATGCAGCACGG + Intronic
902330778 1:15730279-15730301 AAAAATACAAAAATTCAGCCAGG + Intronic
902909009 1:19581309-19581331 AAAAATACAAAAAAGCAGCCAGG - Intergenic
902944298 1:19823624-19823646 AAATATACACAAGTGAGGCCAGG - Intergenic
903327511 1:22579200-22579222 ACATACACACACATGCACACAGG - Intronic
903964744 1:27080104-27080126 AAAAACACACATTTGCAGCCAGG - Intergenic
905467416 1:38165908-38165930 AAAAATACAAAAATGTAGCCAGG + Intergenic
907942005 1:59096942-59096964 AAATACACACACATACACACAGG - Intergenic
908212764 1:61918466-61918488 AAATATACAAAAATTTAGCCAGG - Intronic
908367882 1:63445123-63445145 AAAAATACAAACAATCAGCCGGG + Intronic
908532139 1:65044015-65044037 AAAAATACAAAAATTCAGCCAGG - Intergenic
909018352 1:70404070-70404092 AAATATACACACAAACACACAGG + Intergenic
909070666 1:70990056-70990078 ATATATATACACATACAGCTGGG + Intronic
909563085 1:77026394-77026416 AAAGGCACACACATGCATCCTGG + Intronic
909655060 1:78022360-78022382 AAAAATACAAACATTTAGCCAGG - Intronic
910533094 1:88263650-88263672 AAATAGAAACATGTGCAGCCAGG + Intergenic
910574979 1:88751279-88751301 ATATATACACACATACACTCTGG + Intronic
910725578 1:90334652-90334674 ACATATACACACATACAGCTGGG - Intergenic
911266874 1:95753562-95753584 AAGCATACACACACCCAGCCAGG - Intergenic
912432818 1:109638374-109638396 AAACAGACACACATGAGGCCAGG - Intergenic
913670874 1:121096505-121096527 AAAGAGACACACACACAGCCAGG + Intergenic
914661124 1:149791870-149791892 AAAGAGACACACACACAGCCAGG + Exonic
914895188 1:151664431-151664453 AAATATACAAAGATGAGGCCAGG - Intronic
916215962 1:162394907-162394929 AAAAATACAAAAATGTAGCCAGG - Intergenic
916258634 1:162818057-162818079 AAATATATTCACAAGCACCCAGG + Intergenic
917177375 1:172251568-172251590 ATACACACACATATGCAGCCTGG - Intronic
917341756 1:173986721-173986743 AAAAATACACAGAATCAGCCAGG - Intronic
917871334 1:179244637-179244659 AAATATACAAAAAAGTAGCCGGG - Intergenic
917945640 1:179967903-179967925 ACAAATACACATATGAAGCCAGG - Intronic
917993208 1:180404751-180404773 AAATATGCTCACATGAGGCCAGG - Intronic
918559022 1:185842350-185842372 AAATATCCACCCAGCCAGCCTGG + Intronic
919245525 1:194978113-194978135 AAAAATACACATATGCGGCTGGG - Intergenic
920007215 1:202842195-202842217 ATATACACACACAGGCAGGCAGG - Intergenic
922241493 1:223758153-223758175 AAATAAACTGAAATGCAGCCAGG - Intronic
923205011 1:231750593-231750615 AGTTATTCAAACATGCAGCCAGG - Intronic
924212163 1:241781643-241781665 ACATATACACACATACAGAAAGG + Intronic
924325936 1:242893896-242893918 AAAAATACAAACAATCAGCCAGG + Intergenic
924566463 1:245202778-245202800 AAATACACACAAAAACAGCCGGG + Intronic
1062762134 10:31498-31520 AAAAATACACACAATTAGCCAGG + Intergenic
1063029394 10:2217555-2217577 ACATATGCACACATACGGCCAGG - Intergenic
1063106893 10:2999882-2999904 ACACACACACACATGCAGCATGG + Intergenic
1063135924 10:3216145-3216167 ATGTATACACACATGCACACAGG + Intergenic
1063193655 10:3719867-3719889 AGGTATAGACAAATGCAGCCGGG + Intergenic
1063204376 10:3816632-3816654 AAGCAGACACACATTCAGCCAGG + Intergenic
1063257583 10:4345257-4345279 AAATATACACACACGTATCTGGG - Intergenic
1063599952 10:7471895-7471917 ACACATACACACATACAGCATGG + Intergenic
1064762878 10:18639331-18639353 AAAAATACAAAAATGAAGCCAGG + Intronic
1065198994 10:23296148-23296170 AAATATCGACACATGCATACAGG - Intronic
1065769859 10:29068262-29068284 AAATATACATTGATGCATCCTGG + Intergenic
1065922766 10:30407714-30407736 AAAGATACAAACAAGCAGGCCGG + Intergenic
1066402031 10:35086022-35086044 AAATAAAGAAACAAGCAGCCTGG + Intronic
1066703677 10:38156474-38156496 AGAGATACCCACAGGCAGCCCGG + Intergenic
1066725083 10:38383731-38383753 AAATATATTCACAAGCACCCAGG + Intergenic
1066987053 10:42476478-42476500 AGAGATACCCACAGGCAGCCCGG - Intergenic
1068587380 10:58814439-58814461 TAATGTACACACATGCATCCAGG + Intronic
1068660214 10:59615652-59615674 AAAAATACAAAAATTCAGCCAGG + Intergenic
1069296077 10:66845969-66845991 AAAAATACACAAATTTAGCCGGG + Intronic
1069444813 10:68463281-68463303 AAAAATACAAAAATTCAGCCGGG + Intronic
1069568998 10:69483147-69483169 AAAAATACAAAAAAGCAGCCGGG - Intronic
1069707761 10:70469353-70469375 AAATGCACACACAGGCAGGCTGG + Intergenic
1070298923 10:75188722-75188744 AAAAATACAAAAATTCAGCCAGG - Intergenic
1070549622 10:77480812-77480834 AAAGACACACACGTGCAGCCGGG + Intronic
1070677869 10:78424990-78425012 AAATATACACATTTGCTTCCAGG - Intergenic
1071693742 10:87850471-87850493 AAATATACACACACACACCAAGG - Intergenic
1072195058 10:93110386-93110408 AAATCTGCACAGATGCAGCCAGG - Intergenic
1072900865 10:99405211-99405233 GAATATACACACTTTCAGCTAGG + Intronic
1073056292 10:100705060-100705082 AAAGATACACACACGCAGCTGGG + Intergenic
1073175718 10:101555941-101555963 AAATACACACACGTGCAGCAAGG - Exonic
1073189601 10:101641863-101641885 CAATAGACACACATGTGGCCAGG + Intronic
1074162858 10:110848428-110848450 AAAAATAGGTACATGCAGCCAGG + Intergenic
1075000236 10:118791532-118791554 AAAAATTTACAAATGCAGCCGGG + Intergenic
1075102742 10:119517706-119517728 ACACATACACACATGAATCCAGG + Intronic
1076211615 10:128651007-128651029 ATATATACACACATACACCATGG - Intergenic
1076315714 10:129539665-129539687 AAATATACAAAAATTTAGCCGGG - Intronic
1076315925 10:129541459-129541481 AAAAGTAAACACATACAGCCTGG - Intronic
1076919424 10:133443947-133443969 AGATATACACAGGTGCACCCAGG + Intergenic
1077281045 11:1746168-1746190 AATTACACACACATGCACACAGG + Intronic
1078610253 11:12813484-12813506 AAACATACACACATGAAGTATGG - Intronic
1079204081 11:18398772-18398794 AAAAATACAAACATTTAGCCAGG - Intronic
1079425566 11:20338988-20339010 ACACATACATACATGCAGGCAGG - Intergenic
1079486494 11:20940840-20940862 AAAAATACCCACCTCCAGCCAGG + Intronic
1080653182 11:34238912-34238934 AAAAATACAAAAATTCAGCCAGG - Intronic
1080852991 11:36087492-36087514 ACATATACAAAAATACAGCCTGG - Intronic
1081068526 11:38578497-38578519 AAATGGAAACACATGCAGACAGG - Intergenic
1081310216 11:41561578-41561600 ACATATACACAAATGCATGCAGG + Intergenic
1081732468 11:45381216-45381238 AAAAATACAAAAATGTAGCCGGG - Intergenic
1082277108 11:50233692-50233714 AAATATATATACATCCAGCTTGG + Intergenic
1083084058 11:60124418-60124440 AAATCTACATTAATGCAGCCAGG + Intergenic
1083254606 11:61488463-61488485 AAAAATACAAAAATGTAGCCGGG - Intronic
1083373223 11:62198560-62198582 ACAAATACACACGTGCACCCCGG - Intergenic
1084733210 11:71087922-71087944 AAAAATAGTCAAATGCAGCCAGG - Intronic
1084979884 11:72823366-72823388 ATATATTCACACATACAGACGGG - Intronic
1085168228 11:74424026-74424048 AAAAATACACAAAACCAGCCAGG - Intergenic
1085441651 11:76569539-76569561 AAATATACGCACATTGGGCCAGG + Intergenic
1085872868 11:80371128-80371150 AAATAGAAATACATGCAGGCAGG + Intergenic
1086220994 11:84442988-84443010 AAATATATCCATCTGCAGCCGGG - Intronic
1088603903 11:111511050-111511072 AAATATACATACATGAAACTAGG - Intronic
1089677383 11:120098917-120098939 AAATGCACACAGATGCAGCTGGG - Intergenic
1090345557 11:126066632-126066654 AAAAATACAAACAATCAGCCAGG + Intergenic
1090784834 11:130040083-130040105 AAAAATACAAAAATGTAGCCGGG + Intergenic
1091068794 11:132543350-132543372 AAATGCACACACACACAGCCAGG + Intronic
1091451265 12:573408-573430 AAAGATAAACACGTGCAGTCTGG + Intronic
1091808237 12:3372675-3372697 AAATATATACACATTAACCCAGG + Intergenic
1092467511 12:8746435-8746457 AAAAATACAAACAAGTAGCCGGG + Intronic
1092645046 12:10561508-10561530 AAATATGCATTCATTCAGCCAGG - Intergenic
1093164622 12:15790064-15790086 AAATAGGCTCACAGGCAGCCTGG - Intronic
1093315212 12:17641071-17641093 ACATATACACAAATGCTTCCTGG - Intergenic
1093410413 12:18858424-18858446 ACATACACACACATGCACACAGG + Intergenic
1093598191 12:20987412-20987434 AAATATACACAACTGAAGACTGG - Intergenic
1095654766 12:44656079-44656101 AAATTCACACAGAAGCAGCCAGG + Intronic
1097515492 12:60599966-60599988 AAAAATAAAGACATGCAGACTGG + Intergenic
1099178519 12:79451733-79451755 AAATATACACAAAGGCAACTAGG - Exonic
1100257105 12:92895458-92895480 AAATATTCAGTCATCCAGCCAGG - Intronic
1100359611 12:93863995-93864017 AATGATACACACATGAAGTCGGG + Intronic
1101862812 12:108496883-108496905 AGATAAAAACACTTGCAGCCAGG + Intergenic
1102121364 12:110444128-110444150 AAAAATACAAACAATCAGCCGGG - Intronic
1102264669 12:111473111-111473133 AAATATACAAAAATTAAGCCAGG + Intronic
1102341269 12:112123500-112123522 AAAAATACAAAAATGTAGCCAGG - Intergenic
1102827209 12:115958891-115958913 AAATATACATACAAGCATGCTGG + Exonic
1102975731 12:117205987-117206009 AAAAATACAAAAATACAGCCGGG - Intergenic
1103075350 12:117977971-117977993 TAAAAAGCACACATGCAGCCAGG + Intergenic
1103384239 12:120519397-120519419 AAAAATACACAAAATCAGCCAGG + Intronic
1103483491 12:121266651-121266673 AAATATACAAAAAAGTAGCCAGG - Intronic
1103830913 12:123778397-123778419 AAATATATTCAAATACAGCCAGG + Intronic
1103913667 12:124365092-124365114 AAATACACCCAAATGCAGGCCGG - Intronic
1104309485 12:127641772-127641794 AAAAATACAAAAATGTAGCCAGG - Intergenic
1104740789 12:131171658-131171680 AAATACACACACATACAACTAGG + Intergenic
1104831997 12:131758784-131758806 AAAAATACAAAAATGTAGCCGGG + Intronic
1105459684 13:20572081-20572103 AAATTTTCAAACATGCAGCAAGG + Intronic
1106295232 13:28407181-28407203 ACATTTGCACACATGCAGACAGG + Intronic
1106501154 13:30330281-30330303 AAATATACAGAAATGCAGCCCGG - Intergenic
1107261083 13:38492209-38492231 AAATGTATAAACCTGCAGCCAGG - Intergenic
1107437549 13:40393591-40393613 AAATATACACATATGCAAACCGG + Intergenic
1107463785 13:40630492-40630514 AAAAATACAAAAATGTAGCCAGG + Intronic
1108200039 13:48034194-48034216 TAAAAAACACACATGCGGCCGGG + Intergenic
1108827706 13:54434998-54435020 AAAAATACACAAAAGTAGCCCGG - Intergenic
1109311551 13:60700323-60700345 AAATGCACACACATCCAGCCTGG - Intergenic
1109627000 13:64987666-64987688 ATATATACACACATACACTCAGG + Intergenic
1110146248 13:72193988-72194010 AAGTCTACACACATGTGGCCTGG + Intergenic
1110619797 13:77582385-77582407 AAAAATACAAAAATTCAGCCAGG - Intronic
1110784803 13:79511157-79511179 AAATCTACATTGATGCAGCCAGG - Intronic
1110855349 13:80291482-80291504 AAAGATATACAAATTCAGCCTGG + Intergenic
1111390570 13:87589389-87589411 AAATCCACATACATGCAGGCTGG + Intergenic
1112670924 13:101637502-101637524 AAAAATACAAAAATTCAGCCAGG - Intronic
1112933883 13:104775555-104775577 AAATATACAAAAAAGTAGCCGGG + Intergenic
1113278954 13:108767395-108767417 AAAAATACCCAGATACAGCCAGG - Intronic
1115311286 14:31980890-31980912 AAATATACAAAAATTTAGCCGGG - Intergenic
1115517343 14:34199051-34199073 CACTACACACACATCCAGCCAGG - Intronic
1118840190 14:69503984-69504006 AAATACAAATACAGGCAGCCTGG - Intronic
1119361874 14:74057088-74057110 AACTCTACACACATGAAACCTGG - Exonic
1119661933 14:76458470-76458492 AAACACACACACATGCATGCAGG + Intronic
1119744082 14:77032205-77032227 ATATATACACACATACATGCTGG + Intergenic
1121136756 14:91506104-91506126 AAACATACAAAAATGTAGCCAGG - Intronic
1122515172 14:102302709-102302731 AAATATGTACATATGCTGCCTGG - Intronic
1124846292 15:33294258-33294280 AAACAAACAAACATGCTGCCCGG + Intergenic
1125250235 15:37693558-37693580 ATATATGCATACATGCAGGCAGG + Intergenic
1125356044 15:38818336-38818358 ATATATACACACAGGCACACAGG + Intergenic
1125611440 15:40973819-40973841 AAATATACACACATGCAAATGGG - Intergenic
1126127414 15:45308394-45308416 AAATATACAAAAAAGTAGCCAGG + Intergenic
1126169623 15:45684207-45684229 AAATATACATAAATACAGGCTGG - Intronic
1126643400 15:50851191-50851213 AAAAATACAAACAATCAGCCGGG + Intergenic
1127520273 15:59736602-59736624 ATATACACACACAAGCAGCCAGG - Intergenic
1127875286 15:63106608-63106630 AAAAATACAAAAATCCAGCCGGG - Intergenic
1128707037 15:69843902-69843924 AAATCTACACACACGCTTCCTGG + Intergenic
1129381778 15:75172406-75172428 AAACATACAGACATACAGGCAGG - Intergenic
1130812399 15:87393699-87393721 AAAAATACACAAAAGTAGCCAGG + Intergenic
1131236195 15:90699074-90699096 AAAAATACAAGCAGGCAGCCAGG + Intergenic
1132145786 15:99428708-99428730 GTATATACACACATACAGCAAGG - Intergenic
1132516219 16:367379-367401 AAAGATACACACACACAGCCTGG + Exonic
1132812378 16:1807378-1807400 AAAAATACAAAAATGTAGCCGGG + Intronic
1132988411 16:2780029-2780051 AAATATACAAAAAAACAGCCAGG - Intergenic
1132990894 16:2792786-2792808 AAAAATACAAAAATGTAGCCAGG + Intergenic
1133096340 16:3449212-3449234 AAAAATACAAAAATGTAGCCGGG + Intronic
1133883990 16:9809121-9809143 TAATATATACAAATGCAGACCGG + Intronic
1134128761 16:11634132-11634154 ACTTATACACACATGCACACAGG + Intronic
1134152152 16:11813461-11813483 AAAAATAGCCACATCCAGCCAGG + Intergenic
1134309544 16:13063165-13063187 AAAAATACAAAAATGTAGCCGGG - Intronic
1134670017 16:16047851-16047873 TAATGTGCACACATGCGGCCGGG - Intronic
1135406927 16:22205422-22205444 AAAAATACAAAAAAGCAGCCGGG - Intergenic
1136448901 16:30341142-30341164 AAAAATACACAAAAGTAGCCAGG + Intergenic
1136603637 16:31315616-31315638 AAATATACAAAAAAGTAGCCAGG - Intronic
1136870370 16:33802162-33802184 AAATACACACACATGAACCTTGG + Intergenic
1138365231 16:56470232-56470254 AAATATACAATCATGCACCAAGG + Intronic
1138635225 16:58332969-58332991 TAAAAAACACAGATGCAGCCGGG - Intronic
1138969847 16:62131241-62131263 AAAGATACAGACTTCCAGCCAGG - Intergenic
1139771891 16:69284410-69284432 TAAGACACACAAATGCAGCCTGG + Intronic
1140008893 16:71110223-71110245 ATATATACACACATACATACAGG - Intronic
1140528030 16:75640219-75640241 AAATATAGTCACCTGCAGCCTGG - Exonic
1141044337 16:80703028-80703050 ATATATACACACATGAATCTAGG + Intronic
1141527609 16:84621950-84621972 CAATATAAACAAATGCAGGCTGG - Intergenic
1142283731 16:89162401-89162423 ACATACACACACATGCTGACAGG + Intergenic
1203101802 16_KI270728v1_random:1313888-1313910 AAATACACACACATGAACCTTGG - Intergenic
1142585279 17:968410-968432 AAAGATACACAGATGCAGCCCGG + Intronic
1142846329 17:2679730-2679752 AAATATACACACATACATGAAGG - Intronic
1143318359 17:6050322-6050344 ATAAATATACATATGCAGCCGGG - Intronic
1144246299 17:13369189-13369211 ATATATACACACACGCACCATGG - Intergenic
1144730483 17:17523173-17523195 AAAAAGACAAGCATGCAGCCTGG + Intronic
1145089354 17:19973906-19973928 AAAAATCCAAAAATGCAGCCGGG + Intronic
1147296973 17:39491770-39491792 AAATATATAAACACACAGCCAGG - Intronic
1147326401 17:39671761-39671783 GAACATGCACACAGGCAGCCTGG + Exonic
1149075103 17:52587405-52587427 GAAAACACACACATGCAGCTGGG + Intergenic
1149716883 17:58799601-58799623 AAAAATACAAAAATGTAGCCAGG - Intronic
1149782082 17:59405879-59405901 AAATGTGTAAACATGCAGCCAGG - Intergenic
1150195452 17:63293624-63293646 AAATATAAACAGCTGCAGCTAGG - Intronic
1151723891 17:75873907-75873929 AAGTAAACACTCAAGCAGCCAGG + Intergenic
1152367778 17:79866646-79866668 AAAAATACACAAATTAAGCCAGG - Intergenic
1152955044 18:31828-31850 AAAAATACACACAATTAGCCAGG + Intergenic
1153450789 18:5225831-5225853 AAATATACAAAAAAACAGCCTGG + Intergenic
1153819044 18:8817018-8817040 AAAAATAAACCCAGGCAGCCAGG - Intronic
1155810765 18:30231766-30231788 AAATAAACAAACAAACAGCCAGG - Intergenic
1155951240 18:31915599-31915621 AAAAATACAAAAATGAAGCCGGG + Intronic
1156182911 18:34626768-34626790 GAAGCTACACAGATGCAGCCTGG + Intronic
1157226275 18:45867922-45867944 AAATATACACACATACACTGTGG - Intronic
1158599080 18:58841682-58841704 AAAAATACAAAAATGTAGCCAGG - Intergenic
1159386144 18:67727525-67727547 GAAAATACACACACACAGCCGGG + Intergenic
1159761132 18:72428818-72428840 AAATATATAAACATTTAGCCAGG + Intergenic
1159862694 18:73667970-73667992 AAAAATACAAAAATGCTGCCTGG + Intergenic
1160783307 19:888041-888063 AAAAATACAAAAAAGCAGCCGGG + Intronic
1161213126 19:3078332-3078354 ACATATACACACATGTACTCAGG + Intergenic
1161927292 19:7310738-7310760 AAAAATACACACATACAGCTGGG - Intergenic
1161991783 19:7688514-7688536 AAAAATACAAAAATTCAGCCGGG - Intergenic
1162510577 19:11115763-11115785 AAAAATACAAAAATGTAGCCAGG + Intronic
1162511592 19:11122256-11122278 AAATATACAAAAAAGTAGCCGGG - Intronic
1162878992 19:13643485-13643507 AAATATATATACATGCAGGCAGG + Intergenic
1162925156 19:13927153-13927175 CACTATACACACATGCACACAGG + Exonic
1163470029 19:17490866-17490888 AAAAATACAGAAATGTAGCCTGG + Intronic
1163499921 19:17670105-17670127 AAATATACAAAAAATCAGCCAGG - Intronic
1163579494 19:18129952-18129974 AAAGAAATACACAAGCAGCCAGG + Intronic
1163757905 19:19117642-19117664 AAAAATACACACACACTGCCGGG + Intergenic
1164074822 19:21805168-21805190 AAATATATACACATTTGGCCAGG + Intronic
1164295014 19:23902228-23902250 TGATATACAAACATCCAGCCAGG + Intergenic
1164874221 19:31671914-31671936 ATATACACACACACACAGCCTGG + Intergenic
1166058840 19:40311814-40311836 AAAAATACAAAAATGTAGCCAGG - Intergenic
1167382600 19:49147388-49147410 AAAAATAAACAAATACAGCCAGG + Intronic
1167452115 19:49577260-49577282 AAACATACATCCATGCAGGCGGG + Intronic
924990048 2:306509-306531 TAATACACACACAGGCAGCGAGG + Intergenic
924990095 2:306750-306772 TAATACACACACAGGCAGCGAGG + Intergenic
924990149 2:307030-307052 TAATACACACACAGGCAGCGAGG + Intergenic
925041434 2:734236-734258 AAATCCACACACAGACAGCCCGG + Intergenic
926989500 2:18662421-18662443 GAATATACACACATGAATCATGG - Intergenic
928013367 2:27631102-27631124 AAATACACAGACAAGAAGCCAGG - Intronic
928297775 2:30099781-30099803 ATATATACACACATACACCATGG - Intergenic
928753081 2:34493873-34493895 AAAAATACAAACAAACAGCCGGG - Intergenic
928808575 2:35193599-35193621 ATATATACACACATACACCATGG + Intergenic
928958190 2:36893738-36893760 ACATACACACACATTCACCCTGG + Intronic
928996424 2:37296737-37296759 AAATATACAAAAATTTAGCCGGG + Intronic
929010090 2:37433319-37433341 AAATATACACAACTGCAGAATGG - Intergenic
929700016 2:44153957-44153979 AAATAAACACTGAAGCAGCCGGG + Intergenic
929791623 2:45027501-45027523 AAGTGTACACACATGCAGTCAGG + Intergenic
929869150 2:45743625-45743647 AAATGTACACAGATGTGGCCAGG - Intronic
929931849 2:46263416-46263438 AAACATACACAGATGCGGCCTGG + Intergenic
930759367 2:55016285-55016307 AAAAATACACATATGCGGCCAGG + Intronic
931465362 2:62481993-62482015 AACTAAACACACATTTAGCCTGG + Intergenic
932619084 2:73255407-73255429 ATATATACAGAAATGCAGGCCGG + Exonic
933187755 2:79297618-79297640 AAGTATACAACCATGCAGACTGG + Intronic
933267852 2:80201532-80201554 AAAAATACACAAATTTAGCCAGG - Intronic
934556809 2:95291055-95291077 AAACATAGACACTTCCAGCCTGG - Exonic
934726313 2:96622126-96622148 AAAATTAAACAAATGCAGCCAGG + Intronic
935088932 2:99875769-99875791 AGAGAAACCCACATGCAGCCTGG + Intronic
935133105 2:100275938-100275960 ACATATATACACATGCAGATAGG + Exonic
936292542 2:111237475-111237497 AAAAATACAAAAATGTAGCCAGG - Intergenic
937737790 2:125313077-125313099 CAGCATACACACATCCAGCCGGG - Intergenic
937916075 2:127099341-127099363 ACACACACACACATGCACCCTGG - Intronic
938505908 2:131882883-131882905 ACATATACATATATTCAGCCAGG - Intergenic
938621447 2:133059002-133059024 AAATATTCTGATATGCAGCCAGG + Intronic
939956419 2:148531412-148531434 AAACACACACACATGCATGCAGG - Intergenic
940671482 2:156674729-156674751 AAATATACACACGTGCATGTGGG + Intergenic
942355009 2:175101351-175101373 AAATATATAAATATGCAGACTGG - Intronic
943952140 2:194144647-194144669 AAATCTACATTGATGCAGCCAGG + Intergenic
944205363 2:197152520-197152542 AAAGATACACACAGCCAGCAGGG + Intronic
944290423 2:197998237-197998259 ACACATACACACATGCACACAGG - Intronic
944714422 2:202364579-202364601 AATTGTACACACATACAGCTGGG + Intergenic
944961617 2:204881236-204881258 AGATACACACACATACAGACTGG - Intronic
945598467 2:211826938-211826960 ATATATACACACATGCAAAAGGG - Intronic
946884529 2:224209972-224209994 CAATCTTCACACATGCTGCCTGG + Intergenic
946918209 2:224548840-224548862 AAATATACAAAAATTTAGCCAGG + Intronic
948411623 2:237767012-237767034 AAATATACAAACAATTAGCCAGG + Intronic
948494849 2:238341016-238341038 AAAAATACACATAAGAAGCCGGG - Intronic
1169613271 20:7408108-7408130 AAATATACAAAAATTTAGCCAGG + Intergenic
1170301293 20:14887123-14887145 ATGTATGCACACATACAGCCAGG - Intronic
1172077290 20:32308874-32308896 AAATATACAAAAAATCAGCCGGG - Intronic
1172807755 20:37624900-37624922 ACACATACAAACATGCAGACAGG - Intergenic
1173466053 20:43282289-43282311 AAACACAGACACATACAGCCTGG - Intergenic
1173576093 20:44113698-44113720 AAATAAACAGGCAGGCAGCCAGG - Intronic
1173874385 20:46360842-46360864 AAAAATCAACAAATGCAGCCGGG - Intronic
1174004488 20:47399711-47399733 ACAAATACACATATACAGCCAGG - Intergenic
1174794615 20:53511603-53511625 ATATATACATATATCCAGCCGGG + Intergenic
1174967446 20:55233743-55233765 AAATATAAAAAGATACAGCCGGG - Intergenic
1174993608 20:55541285-55541307 CAACATACATACATGCAGCATGG - Intergenic
1175293269 20:57892467-57892489 AAATAATCACACTGGCAGCCAGG + Intergenic
1175432105 20:58912590-58912612 AAATAAACACACATAAAACCTGG + Intergenic
1176217123 20:63953404-63953426 AGAAATACACACAGGCAGCCGGG + Intronic
1176700352 21:10040526-10040548 AAATATACACACATTCAGCCGGG + Intergenic
1176900888 21:14440617-14440639 AAATATACAAAAATTTAGCCAGG - Intergenic
1176904205 21:14479922-14479944 AAATATATATATATACAGCCGGG - Intergenic
1177680638 21:24364608-24364630 ACATATACACACATGCATGGAGG + Intergenic
1178069508 21:28948029-28948051 AAATATACAAAAAATCAGCCGGG + Intronic
1178373398 21:32046720-32046742 AAAAATACACAAAATCAGCCGGG - Intergenic
1178555200 21:33584340-33584362 ATATATACAGACAGGCAGGCCGG - Intronic
1179172963 21:38987232-38987254 AAACACACACACATGAAGTCAGG + Intergenic
1179181502 21:39049252-39049274 AAATATATATATATGCGGCCAGG + Intergenic
1179644828 21:42769225-42769247 ACATATACACATATGCACACAGG + Intronic
1179644854 21:42769688-42769710 ACACATACACACATGCACACAGG + Intronic
1179958457 21:44754346-44754368 AAATATACAAAAAATCAGCCGGG + Intergenic
1180598202 22:16993653-16993675 AAATACACAACCATGCTGCCTGG + Intronic
1180629710 22:17219969-17219991 AAATAAACCCACATGCGGCCGGG - Intronic
1181123519 22:20688733-20688755 AAAAATACAAAAAAGCAGCCGGG + Intergenic
1181927451 22:26371470-26371492 GAATATACACAAATGTAGCTGGG + Intronic
1182220341 22:28753675-28753697 AAATATACAAAAAATCAGCCAGG + Intronic
1182297617 22:29318883-29318905 AAAGAGACAGACATGCAGCTAGG + Intronic
1182476294 22:30578434-30578456 AAATACAAACTCATGCACCCTGG - Intronic
1182749521 22:32630275-32630297 AAAAATACATACATACGGCCGGG - Intronic
1182932048 22:34183721-34183743 ACACACACACACATGCTGCCTGG - Intergenic
1183144884 22:35981345-35981367 AAAAATCCAAACATTCAGCCAGG + Intronic
1183187792 22:36302249-36302271 TATTATACACAAAAGCAGCCCGG + Intronic
1183561099 22:38573850-38573872 AAATAAACAGATATGCGGCCAGG - Intergenic
1183705582 22:39473340-39473362 AAGTATCCACACATGGAGACGGG + Intronic
1185094995 22:48801295-48801317 ATACATACACACATGCACACAGG + Intronic
1185152983 22:49177039-49177061 ACAAACACACACATGCAGCAGGG + Intergenic
1185256469 22:49835870-49835892 AAAAATACACAAATATAGCCAGG + Intergenic
949226108 3:1698037-1698059 AAATAAATATACATACAGCCAGG - Intergenic
949277829 3:2307272-2307294 AAAAATACAAAAATGTAGCCGGG + Intronic
949402014 3:3674916-3674938 GAATTTACACAAAGGCAGCCTGG - Intergenic
949654403 3:6200311-6200333 AAATATACAAAAAATCAGCCGGG + Intergenic
950145351 3:10645990-10646012 AGACATTGACACATGCAGCCTGG + Intronic
950272418 3:11628657-11628679 AAAAATACAAACATTTAGCCGGG + Intronic
950687676 3:14630204-14630226 AAAAATACAAAAATTCAGCCGGG + Intergenic
951006908 3:17628071-17628093 AAAAATACACACACTCCGCCGGG + Intronic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953870062 3:46618543-46618565 AAAAATATATACATGCGGCCGGG + Intronic
954271051 3:49509435-49509457 AAAGATACACACATCAAGTCTGG + Intronic
955695771 3:61634532-61634554 AAAAACACACACACACAGCCGGG - Intronic
956053633 3:65275774-65275796 ACATTTACACACATGCACACAGG + Intergenic
957892734 3:86380696-86380718 AAATATATACACATCAGGCCGGG - Intergenic
957897203 3:86438294-86438316 AAATATACAAACAATTAGCCTGG - Intergenic
958717584 3:97804189-97804211 AAATCTGCACTGATGCAGCCAGG + Intergenic
958726691 3:97914261-97914283 AAATACACACACACACAGCAAGG + Intronic
959579498 3:107969113-107969135 ATATATACACACACACAGCAAGG + Intergenic
959726420 3:109547488-109547510 AAATTTACATACATGCAACAAGG - Intergenic
960093703 3:113667582-113667604 AAAAATACATACATGGAGCCGGG + Intronic
960426017 3:117508827-117508849 AAATAAGCATACATACAGCCAGG + Intergenic
960678481 3:120221822-120221844 AAAAATACAAAAATACAGCCAGG - Intronic
961831649 3:129626160-129626182 AAATGTAGACACGTGCATCCTGG + Intergenic
963497317 3:146082595-146082617 AAATAAACACACATCGGGCCCGG + Intronic
963524526 3:146400773-146400795 ATATATACACACACGGAGCTAGG - Intronic
963961163 3:151310698-151310720 AAATTTAAACAAATGAAGCCTGG - Intronic
964323323 3:155520353-155520375 AGAGATATACACATGCAGACTGG + Intronic
964619995 3:158711753-158711775 AAAAATACACACAATTAGCCAGG - Intronic
965085607 3:164092035-164092057 AAATACAAAAACATTCAGCCAGG - Intergenic
965600596 3:170450657-170450679 AGAAATACAAAAATGCAGCCGGG - Intronic
965819568 3:172671645-172671667 ATACATACACACATGCACACAGG + Intronic
965819570 3:172671738-172671760 ATACATACACACATGCACACAGG + Intronic
966172685 3:177100076-177100098 AAATATACAAAAAATCAGCCAGG + Intronic
966252627 3:177883647-177883669 AATTATTCTCATATGCAGCCAGG + Intergenic
967554978 3:190846066-190846088 AAAAATACACAAATTTAGCCAGG + Intergenic
969146013 4:5124719-5124741 ACACATACACACATGCATACAGG - Intronic
969431178 4:7155367-7155389 CAATACACACACATGCACACAGG + Intergenic
969458468 4:7314498-7314520 AAAAATACAAAAATGTAGCCGGG - Intronic
970953737 4:21786498-21786520 AAATAAATAAACATACAGCCTGG - Intronic
971290126 4:25329827-25329849 AAATATAAAAACATCCGGCCAGG - Intronic
972022584 4:34334709-34334731 AAAAATACAAACAGGTAGCCGGG + Intergenic
972092098 4:35300074-35300096 AAATATATAGACCTGCTGCCTGG - Intergenic
972162686 4:36244953-36244975 AAATTTACATAGAAGCAGCCTGG - Intergenic
972417998 4:38861614-38861636 AAATACACACCCATGCTGACTGG + Intergenic
972653324 4:41041173-41041195 AAAATTTCACACATGTAGCCGGG - Intronic
974363491 4:60914974-60914996 AAATATACATCCAACCAGCCTGG - Intergenic
975440446 4:74404362-74404384 ACATATACACACACTCAGACTGG - Intergenic
975448394 4:74495207-74495229 AAAAATACAAACAATCAGCCGGG - Intergenic
975557705 4:75681027-75681049 AAATATAGTCAAATTCAGCCAGG + Intronic
976272036 4:83240235-83240257 ACATACACACACATGCACACAGG + Intergenic
976947766 4:90791553-90791575 AAAGATACACACTTTTAGCCGGG + Intronic
977825330 4:101524410-101524432 AAATCTGCACAGATGCATCCAGG - Intronic
978013970 4:103721001-103721023 AAATTTATACACATGCCCCCAGG - Intergenic
978180983 4:105795551-105795573 ATAGATACACACATGCACACAGG - Intronic
978377649 4:108092750-108092772 AAATACACACATATGCACACGGG - Intronic
978458996 4:108929543-108929565 AAATATAAAAAGATGCAGGCTGG + Intronic
978896452 4:113894266-113894288 ACATATACCCACAAGCAGCACGG + Intergenic
979179147 4:117703794-117703816 AAATATACCCAGATGCAGGCTGG + Intergenic
979689010 4:123541010-123541032 AAATATACACAAAATTAGCCGGG + Intergenic
980372769 4:131899305-131899327 AAATATACACACATTCGGCCGGG + Intergenic
980951184 4:139378816-139378838 AATCATACACTCATGAAGCCAGG - Exonic
981055449 4:140356297-140356319 AAATATACACTAATGTATCCAGG - Intronic
983251718 4:165353474-165353496 AAATATACAAACAGCCAGCCAGG + Intergenic
983329947 4:166313029-166313051 TAATAAAAACACATGCAGGCTGG - Intergenic
983608246 4:169614482-169614504 AAACACACACACAAGAAGCCTGG - Intronic
984085993 4:175311815-175311837 AAATATACAAAAAATCAGCCAGG - Intergenic
985483946 5:138490-138512 AAAGAGACACACATGCAGATGGG - Intergenic
987057412 5:14207418-14207440 ACACACACACACACGCAGCCAGG + Intronic
987489834 5:18565206-18565228 ATATATACACACATACACACAGG - Intergenic
987884072 5:23790142-23790164 ATATATACACACACACATCCTGG + Intergenic
988955249 5:36309917-36309939 AAATATACAAAAATTTAGCCAGG - Intergenic
989982829 5:50664503-50664525 ACATACACACACATGCATTCAGG - Intergenic
990409858 5:55531349-55531371 ATATACACACACATGCACACAGG + Intronic
990447306 5:55904714-55904736 AAATATACACACAGCCTGCTGGG + Intronic
990751175 5:59018299-59018321 AAATGTACAGACAGGCAGACAGG + Intronic
991324241 5:65412402-65412424 ACACATACACACATGCACACAGG + Intronic
993174495 5:84466089-84466111 AGAAATACATACAAGCAGCCTGG - Intergenic
994116666 5:96068852-96068874 ATATATACACACAGGAAGACAGG - Intergenic
994597997 5:101863884-101863906 AAATCAACACCCATTCAGCCGGG + Intergenic
994761252 5:103856960-103856982 AAAAATACAAAAAAGCAGCCAGG - Intergenic
995072568 5:107941514-107941536 AAAAATACATGCTTGCAGCCAGG - Intronic
995417526 5:111926850-111926872 AAATAGTCACACTTGCACCCAGG - Intronic
995589914 5:113688571-113688593 AAAAATACAAAAATTCAGCCAGG - Intergenic
996027720 5:118667402-118667424 ATATATATAAACATACAGCCAGG + Intergenic
996489264 5:124073474-124073496 TAAAACACACAGATGCAGCCTGG - Intergenic
996719323 5:126614405-126614427 ACATATACACACTTGTGGCCGGG - Intronic
996884330 5:128338167-128338189 AAATATTCACACATACAGCGTGG + Intronic
997936367 5:138114892-138114914 AAATATACAAACAATTAGCCGGG - Intergenic
998457209 5:142282579-142282601 AAAAATACAAAAATTCAGCCAGG + Intergenic
999736303 5:154515869-154515891 AAATATACACACTTGTGGCTGGG - Intergenic
1000416499 5:160989772-160989794 AAACATACACACATGCACAATGG - Intergenic
1000685039 5:164238111-164238133 AAAAATACAAAAATGTAGCCGGG + Intergenic
1000773454 5:165386502-165386524 AAAAATACAAACAAGTAGCCAGG + Intergenic
1001509526 5:172309674-172309696 AAATACAAAAAAATGCAGCCGGG + Intergenic
1001849797 5:174953474-174953496 TAAAATATACACATGCGGCCGGG - Intergenic
1002809282 6:611228-611250 AGATCTGCACACATGCAGCATGG - Intronic
1003252087 6:4438091-4438113 AAATATACTCATATGTATCCTGG + Intergenic
1004538781 6:16528881-16528903 AAAAATAAGCACTTGCAGCCGGG + Intronic
1004647858 6:17580431-17580453 ATATATATACACATACAGGCTGG - Intergenic
1005594542 6:27366813-27366835 AAATAAAGACAAAAGCAGCCAGG - Intergenic
1005903857 6:30243339-30243361 AAAAATACAAAAATGAAGCCGGG + Intergenic
1005911921 6:30318219-30318241 AAAAACAGACACATGCAGTCTGG - Intergenic
1006123983 6:31825964-31825986 AAACTTAGACACATTCAGCCTGG + Intergenic
1006488043 6:34360925-34360947 AAATATATACATATGGGGCCAGG + Intronic
1006526901 6:34614120-34614142 AAATAAACATACATGAATCCTGG + Intronic
1007844943 6:44746106-44746128 CTATAAAAACACATGCAGCCGGG - Intergenic
1008221770 6:48863059-48863081 AAATATACAAAAAAGTAGCCAGG + Intergenic
1008933724 6:56967128-56967150 AAATAGACACACAGGCAATCAGG + Intronic
1010219008 6:73431308-73431330 AAAAATACAAACATTTAGCCGGG + Intronic
1010464673 6:76153373-76153395 AAATATACACACACACTGTCAGG - Intergenic
1010546484 6:77163967-77163989 AAATATACACAAAATTAGCCGGG + Intergenic
1010774273 6:79867378-79867400 AAATTTAAACACATGCAGTTTGG - Intergenic
1011594112 6:88999474-88999496 AAAAATACAGACAAACAGCCAGG - Intergenic
1011841855 6:91510805-91510827 AAAAATACAAAAATGTAGCCAGG + Intergenic
1011924146 6:92621149-92621171 AAAAATATACACATGCACACTGG - Intergenic
1011958710 6:93058116-93058138 AAATAAACACATATACAGACAGG + Intergenic
1012626363 6:101408346-101408368 ACACATACACACATGCAGCAGGG + Intronic
1012764139 6:103342855-103342877 ATACATACACACATGCATCAGGG - Intergenic
1012781420 6:103563252-103563274 AAAAATACACATATATAGCCAGG - Intergenic
1013939375 6:115643785-115643807 AAATATACACACATACATACAGG + Intergenic
1014027844 6:116669708-116669730 AAAAATACATACATACGGCCGGG - Intergenic
1015075252 6:129148809-129148831 AAATATACCCACTTCAAGCCTGG + Intronic
1015856344 6:137629128-137629150 ATATATACACACATACTGACAGG - Intergenic
1016271869 6:142299928-142299950 AAATTTACAGTCAGGCAGCCTGG - Intergenic
1017516291 6:155158764-155158786 AAAAAAAAACACTTGCAGCCTGG - Intronic
1018287725 6:162258471-162258493 TAATTTACACACAGGCACCCTGG + Intronic
1019099899 6:169621216-169621238 ATATACACACACATGCACACAGG + Intronic
1019753899 7:2753715-2753737 AAACATACACTTATACAGCCCGG - Intronic
1020221039 7:6237412-6237434 TATTAAAAACACATGCAGCCCGG + Intronic
1020375063 7:7476179-7476201 GCATATACACACATACTGCCCGG - Intronic
1020938886 7:14505622-14505644 AATTATACACACACACAGTCAGG - Intronic
1022173463 7:27851351-27851373 AAAAATACACACATCAAGGCTGG + Intronic
1023867764 7:44246595-44246617 ATGTATACACACATGCACACAGG + Intronic
1024364398 7:48504536-48504558 AAATATACACACACACACCCTGG - Intronic
1024464253 7:49694419-49694441 AAATATACACACAGCCAAACAGG + Intergenic
1025061197 7:55809991-55810013 AAAAATACACAAAATCAGCCTGG - Intronic
1025533574 7:61920357-61920379 AAATATACAAAAAATCAGCCAGG - Intergenic
1026036565 7:66833983-66834005 AAAAATACAAACATGTGGCCGGG - Intergenic
1026100536 7:67380559-67380581 AAAGATAAACACATGCATGCAGG - Intergenic
1026365755 7:69646729-69646751 AAGTATACACAAAGACAGCCTGG - Intronic
1026715856 7:72788826-72788848 AAAAATACAAACATGTGGCCGGG - Intronic
1026982911 7:74537112-74537134 AAAAATACAAACATGCAGCTGGG + Intronic
1027111857 7:75446342-75446364 AAAAATACAAAAATGTAGCCAGG - Intronic
1027214033 7:76172757-76172779 AAAAATACAAACATGAGGCCAGG + Intergenic
1027284087 7:76630873-76630895 AAAAATACAAAAATGTAGCCAGG - Intergenic
1027340041 7:77197375-77197397 AAATATCCTCACATGCAGACTGG - Intronic
1028181923 7:87734284-87734306 ATATAGACACACATGCACCTAGG - Intronic
1030051345 7:105540555-105540577 AAAAATACAAAAATTCAGCCGGG - Intronic
1031259607 7:119501721-119501743 TAAAATCCACACATACAGCCAGG + Intergenic
1031501263 7:122520326-122520348 AAAAACACACACATTCAACCGGG - Intronic
1031877245 7:127155739-127155761 AAATAAGCACACAAACAGCCTGG + Intronic
1032353167 7:131184840-131184862 AAAGATGCACACACCCAGCCAGG + Intronic
1032371829 7:131363190-131363212 AAAAATTCACAAATGCGGCCTGG - Intronic
1033339824 7:140483311-140483333 AAATCTACACTGAGGCAGCCCGG + Intergenic
1034130696 7:148714013-148714035 AAATATACACACATGCAGCCAGG - Intronic
1034693564 7:153034209-153034231 AAATATACACAAATTCATCATGG + Intergenic
1035041660 7:155932594-155932616 ACACATACACACATGCACACAGG - Intergenic
1035041663 7:155932794-155932816 ACACATACACACATGCACACAGG - Intergenic
1035146584 7:156823793-156823815 TATAATACACACATGCAGCCGGG + Intronic
1037484229 8:19332338-19332360 TAAAATAGGCACATGCAGCCAGG + Intronic
1038745727 8:30253172-30253194 AAATATTTGCACATTCAGCCTGG - Intergenic
1039269812 8:35868500-35868522 AAATACACACACACACAGACTGG - Intergenic
1039447742 8:37646229-37646251 AAATCCACACGCCTGCAGCCTGG + Intergenic
1040570713 8:48606745-48606767 AAAAATACAAACATTTAGCCAGG + Intergenic
1040810075 8:51441904-51441926 AATAATACACACATGAAGCCTGG + Intronic
1041200089 8:55445350-55445372 AAACATTCACACATGTGGCCGGG - Intronic
1041406631 8:57506282-57506304 AAAAAGACACACATGCATGCTGG - Intergenic
1042292804 8:67187397-67187419 AGAAATAGACTCATGCAGCCTGG + Intronic
1042481542 8:69308988-69309010 AAACATACACAATTCCAGCCTGG - Intergenic
1042493032 8:69423210-69423232 ATATATACACACATGTAGAGGGG - Intergenic
1042608481 8:70571523-70571545 AAATATATACACAGGGAGCCAGG - Intergenic
1042655261 8:71088808-71088830 AAATGTACACACAAGCATCATGG - Intergenic
1043581609 8:81721506-81721528 AGAAATACCCACCTGCAGCCGGG + Intronic
1044216861 8:89622591-89622613 ATATATACACACATGCACACAGG - Intergenic
1044431409 8:92111990-92112012 GAAAATACAGACATGAAGCCAGG - Intergenic
1045065295 8:98438659-98438681 ATAGATACACACATGCACACCGG - Intronic
1045218390 8:100172457-100172479 AAAAATACAAACAATCAGCCAGG + Intronic
1047369900 8:124247502-124247524 AAATGGACCCACCTGCAGCCCGG + Intergenic
1047582549 8:126232157-126232179 AAATATACATACAAGCATGCTGG - Intergenic
1047625389 8:126650868-126650890 ACATACACACACATGCACGCAGG + Intergenic
1048774642 8:137932357-137932379 AAAAATACAAAAATTCAGCCTGG - Intergenic
1048777182 8:137960083-137960105 AAGCATACACACTTGGAGCCAGG + Intergenic
1048899712 8:139025611-139025633 AAATATATACACACGCAGAGTGG + Intergenic
1049366924 8:142243890-142243912 AAATATACAAAAAAGAAGCCGGG + Intronic
1049882149 8:145072546-145072568 AAAAATACACACAATTAGCCAGG - Intergenic
1050170954 9:2816033-2816055 AAAGATACACACATGAAGTAGGG + Intronic
1050440228 9:5654211-5654233 AAAAATACACACTTGCAGCCTGG - Intronic
1050842163 9:10164734-10164756 ATATATACACACATACATCCAGG + Intronic
1051556784 9:18392602-18392624 ACATGTACACACAGGTAGCCTGG - Intergenic
1051645353 9:19262725-19262747 AAAAATACAAAAATGTAGCCAGG - Intronic
1051702864 9:19843107-19843129 AAAAATAAAGATATGCAGCCAGG + Intergenic
1052197638 9:25736838-25736860 ATATATACACATATGCATGCAGG - Intergenic
1052792810 9:32891850-32891872 AATTATACATACATGAAGCTTGG - Intergenic
1053596443 9:39566602-39566624 AGATCTGCACACAGGCAGCCTGG + Intergenic
1053614637 9:39750795-39750817 AGATCCACACACATGCAGCTTGG - Intergenic
1053619210 9:39798816-39798838 AAGCATGCACACATGCAGCTGGG + Intergenic
1053637555 9:40027348-40027370 AAATATACACACATTCGGCCGGG + Intergenic
1053768527 9:41437891-41437913 AAATATACACACATTCAGCCGGG - Intergenic
1053854407 9:42323242-42323264 AGATCTGCACACAGGCAGCCTGG + Intergenic
1053877368 9:42558165-42558187 AAGCATGCACACATGCAGCTGGG + Intergenic
1053895295 9:42736523-42736545 AAGCATGCACACATGCAGCTGGG - Intergenic
1053900084 9:42787184-42787206 AGATCCACACACATGCAGCTTGG + Intergenic
1054234327 9:62543557-62543579 AAGCATGCACACATGCAGCTGGG - Intergenic
1054238881 9:62591597-62591619 AGATCCACACACATGCAGCTTGG + Intergenic
1054261552 9:62870412-62870434 AGATCCACACACATGCAGCTTGG - Intergenic
1054264947 9:62908613-62908635 AAGCATGCACACATGCAGCTGGG - Intergenic
1054318343 9:63623918-63623940 AAATATACACACATTCGGCCGGG + Intergenic
1054547194 9:66349372-66349394 AAATATACACACATTCGGCCGGG - Intergenic
1054553010 9:66626119-66626141 AGATCCACACACATGCAGCTTGG + Intergenic
1054569816 9:66798416-66798438 AGATCTGCACACAGGCAGCCTGG - Intergenic
1055029440 9:71758683-71758705 AAATATGCATTAATGCAGCCAGG - Intronic
1055110368 9:72553266-72553288 AAATATACAGAATTGGAGCCAGG - Intronic
1055294900 9:74824309-74824331 AAAAATACAAAAAAGCAGCCGGG - Intronic
1055509997 9:76986639-76986661 ATATATACATACACTCAGCCAGG + Intergenic
1055662280 9:78516510-78516532 AAATAAAGACACATGTGGCCAGG - Intergenic
1055923404 9:81485745-81485767 AAATATATACACTTACAGCTAGG + Intergenic
1057242277 9:93422109-93422131 AAATACACACACATTTTGCCAGG + Intergenic
1057362933 9:94391726-94391748 AAATATACAAAAAATCAGCCAGG + Intronic
1057572225 9:96213354-96213376 ATATATGCAGACATGAAGCCAGG + Intergenic
1057614121 9:96573011-96573033 AAAAATACAGACACGAAGCCAGG + Intronic
1057620015 9:96626470-96626492 AAATAAAATCAAATGCAGCCGGG - Intergenic
1057740787 9:97709658-97709680 AAAAACACACACAGGCGGCCAGG + Intergenic
1058143284 9:101381050-101381072 ACAAATACACACACACAGCCAGG - Intronic
1058169130 9:101657871-101657893 AAAGAGACACAGATGCAGGCAGG - Intronic
1058916256 9:109568689-109568711 GAAAACACACACATGCTGCCTGG - Intergenic
1060470644 9:123945358-123945380 AAAAATACAAACAATCAGCCGGG + Intergenic
1060753152 9:126187805-126187827 AAATATACACAAAAGTTGCCTGG - Intergenic
1060842039 9:126801367-126801389 AAAAATAAAAACATTCAGCCTGG - Intergenic
1061731175 9:132615298-132615320 AAATAAACAAACCTCCAGCCTGG + Intronic
1061883744 9:133580602-133580624 AAATTTACCCAAATGCAGTCAGG + Intronic
1202785363 9_KI270719v1_random:10591-10613 AAATATACACACATTCGGCCGGG + Intergenic
1203369508 Un_KI270442v1:289532-289554 AAATATATGCAAATGCTGCCTGG + Intergenic
1185495011 X:547893-547915 AAAAATACAAAAATTCAGCCGGG + Intergenic
1185731853 X:2467997-2468019 AAAGGTGCACAAATGCAGCCAGG + Intronic
1185816753 X:3163459-3163481 AAAAATACAAACATTTAGCCAGG - Intergenic
1186259227 X:7758147-7758169 AAAAATCCAGACATGTAGCCTGG - Intergenic
1186830295 X:13383469-13383491 AAATCTGCACTGATGCAGCCAGG - Intergenic
1187316948 X:18205443-18205465 AAAAATACAAAAATGTAGCCAGG + Intronic
1188016722 X:25114481-25114503 ATAAATAAACAAATGCAGCCGGG - Intergenic
1189927878 X:45975749-45975771 AAATATAAACACATGGAGGGGGG + Intergenic
1190264407 X:48818907-48818929 AGACATACACACAAACAGCCAGG - Intronic
1191963226 X:66726648-66726670 AAATATACAAAAAATCAGCCGGG - Intergenic
1192107847 X:68333339-68333361 AAGCACACACACATGCGGCCGGG + Intronic
1193247099 X:79242180-79242202 AAATAAACACAAATGCAGGTGGG - Intergenic
1193370208 X:80687085-80687107 ATATATACACACATACAGATAGG - Intronic
1194159271 X:90431212-90431234 AAACATACACACATACATCTTGG + Intergenic
1195492431 X:105486929-105486951 AAAAATACAAAAAAGCAGCCAGG + Intronic
1195758349 X:108221104-108221126 AAAAATGCAGAAATGCAGCCTGG + Intronic
1197328553 X:125124637-125124659 AAATATATACATATGCATCATGG - Intergenic
1197601591 X:128537511-128537533 CAATATATACACATGCACACGGG - Intergenic
1197756094 X:129995923-129995945 AAATGTACACACACCCAGCAAGG - Intronic
1198447906 X:136737022-136737044 ACACATTCATACATGCAGCCTGG - Intronic
1198765304 X:140074189-140074211 AAATACACACACATGCAAATGGG + Intergenic
1198771663 X:140137391-140137413 AAATACACACACATGCAAATGGG + Intergenic
1200174866 X:154107060-154107082 AAAAATACAAACATTTAGCCGGG + Intergenic
1200505575 Y:4008181-4008203 AAACATACACACATACATCTTGG + Intergenic
1201510069 Y:14749338-14749360 AAATAGACACACCTCTAGCCAGG - Intronic
1201564778 Y:15354598-15354620 AAAAATACAAAAATCCAGCCAGG + Intergenic
1201650992 Y:16286005-16286027 ATATATACACACATATATCCTGG - Intergenic
1202143837 Y:21757622-21757644 AAATATAAATAAATGCAGACAGG - Intergenic