ID: 1034136226

View in Genome Browser
Species Human (GRCh38)
Location 7:148772825-148772847
Sequence AGGCTACGTCCAGACCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 107}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034136226_1034136230 18 Left 1034136226 7:148772825-148772847 CCTGCAGGGTCTGGACGTAGCCT 0: 1
1: 0
2: 1
3: 16
4: 107
Right 1034136230 7:148772866-148772888 AGTAAGCAGCCTGCCTGTCTCGG 0: 1
1: 0
2: 2
3: 18
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034136226 Original CRISPR AGGCTACGTCCAGACCCTGC AGG (reversed) Intronic
901323234 1:8351857-8351879 TGGCCATGTCCACACCCTGCAGG + Intergenic
901661351 1:10799770-10799792 AGGCGACGGCCAGACCTTGAAGG - Intergenic
902299757 1:15493574-15493596 TGGCTCTGTCCAGACCCTGAAGG - Intronic
903227198 1:21900429-21900451 GGGCTATGTCCAGGCCCTCCTGG + Intronic
904304146 1:29576517-29576539 AGCCTACGTCCAGTCCCAGCAGG - Intergenic
905366690 1:37455413-37455435 TGGCCACCTGCAGACCCTGCAGG - Intergenic
911444027 1:97968744-97968766 AAGCTACGTATAGTCCCTGCAGG + Intergenic
918105636 1:181413251-181413273 ACGCCACGTCCTGGCCCTGCCGG + Intronic
1063077644 10:2732879-2732901 AGTCTACATTCAGAGCCTGCTGG + Intergenic
1065915943 10:30355126-30355148 AGGCAGGGTCCAGATCCTGCAGG + Intronic
1067831069 10:49611289-49611311 AGGCTGAGCCCAGGCCCTGCAGG - Exonic
1069724603 10:70569081-70569103 AGACAACTTCCATACCCTGCTGG - Intergenic
1071458429 10:85869009-85869031 AGGCTACCTCCAGATGCTGCAGG - Exonic
1074431864 10:113401262-113401284 AGGCGTCGTCCTGACCTTGCTGG - Intergenic
1075857114 10:125638805-125638827 AGGCTTCATGCAGCCCCTGCTGG - Intronic
1076164808 10:128273176-128273198 AGGCTGCATCCAGACTCTCCTGG - Intergenic
1081707084 11:45188772-45188794 AGGCTACCCTCAGACACTGCAGG + Intronic
1083712136 11:64556038-64556060 GGGCCTCTTCCAGACCCTGCAGG + Exonic
1084325953 11:68400134-68400156 AGGCTACAGCCAGCCCCAGCCGG + Intronic
1085314213 11:75534501-75534523 ATGCCAAGTACAGACCCTGCTGG - Intergenic
1087020653 11:93599460-93599482 AGGCGACCTCCTGACCGTGCAGG - Intergenic
1091303346 11:134521820-134521842 AGGCTACCTCCAGATCCTGGAGG + Intergenic
1097180212 12:57167569-57167591 AGGCTACAGCCAGGCCCTCCAGG + Intronic
1104844616 12:131840566-131840588 TGGGAACGTCCGGACCCTGCAGG - Exonic
1118477134 14:66128101-66128123 AGGCAACGTCCATACCCTAAAGG - Intergenic
1119912176 14:78359642-78359664 AGGCATCGTCCACACCCTCCTGG - Intronic
1121413650 14:93764147-93764169 AGACTAAGTCCAGAATCTGCAGG + Intronic
1121581732 14:95037071-95037093 AGGCTCACTCCAGAGCCTGCAGG + Intergenic
1122297470 14:100713521-100713543 AGGCTCCATCCAGCCCCTCCTGG - Intergenic
1124123387 15:26911817-26911839 AGGCTGCTTCCAGACCCAGTGGG + Intronic
1126530873 15:49710414-49710436 AGCCTGCCTGCAGACCCTGCTGG - Intergenic
1127289244 15:57555383-57555405 AGCCTGTGTCCAGAGCCTGCTGG + Intergenic
1127916659 15:63460584-63460606 AGGCTGCGTGGAGACCCTGGAGG - Intergenic
1129644623 15:77419502-77419524 CGGCTCCGTCCCGACGCTGCCGG + Intronic
1136071562 16:27790762-27790784 AGGCCAGGGCCAGACACTGCAGG - Exonic
1147925467 17:43942900-43942922 AGGCTACAGCCAGAGCCTCCAGG + Intergenic
1149374484 17:56030555-56030577 AGGCAACCTCCAGACCCTGCAGG - Intergenic
1150641501 17:66952858-66952880 AGGCAAGGACCAGACCCTGGAGG + Intergenic
1152465731 17:80465038-80465060 ATGCTACGTCCAAGACCTGCAGG - Intergenic
1153822518 18:8844400-8844422 AGGCCACTTCTAGACCCTACTGG + Intergenic
1154124490 18:11678103-11678125 AGTCTACGGCTAGACCGTGCGGG - Intergenic
1154272143 18:12929532-12929554 AAGCTAGGACCTGACCCTGCTGG - Intronic
1159957000 18:74525845-74525867 GGGCTAAGTCCAGACCTTGCTGG + Intergenic
1161667331 19:5585307-5585329 AGGCTCCGTCCTGAGCCTCCTGG - Intergenic
1162142273 19:8592043-8592065 AGGCTCCGTCCACACCCTCTGGG + Exonic
1162311729 19:9912273-9912295 AGGCTTTGTCCAGCCCCTGGTGG - Intronic
1165114801 19:33522322-33522344 AAGCAAGGGCCAGACCCTGCGGG + Intergenic
1165324878 19:35108790-35108812 AGGCCCCATCCAGCCCCTGCGGG - Intergenic
1166792253 19:45405180-45405202 GGGCTACGTCCTGTCCCTCCGGG - Intronic
1168176834 19:54632793-54632815 AGGCTCCGCACAGGCCCTGCCGG + Intronic
1168187622 19:54709884-54709906 AGGCTCCGCACAGGCCCTGCTGG + Intergenic
925510148 2:4616395-4616417 AGGATACCTCAATACCCTGCAGG + Intergenic
925909690 2:8565712-8565734 AGGATGTGTCCAGAGCCTGCTGG - Intergenic
936661348 2:114547325-114547347 TGCCTGCATCCAGACCCTGCAGG - Intronic
947722848 2:232380029-232380051 ACCCCACCTCCAGACCCTGCTGG - Intronic
947727194 2:232408110-232408132 ACCCCACCTCCAGACCCTGCTGG - Intronic
948180103 2:235972878-235972900 AGGCTAAAGCCAGACCCTGGGGG - Intronic
948524975 2:238566046-238566068 GGGCTGGGTCCAGACTCTGCTGG + Intergenic
948568512 2:238901683-238901705 AGGCTGGGTCCAGACTCGGCAGG + Intronic
1168890839 20:1294621-1294643 TGGCTGTGTCCAGACCCTCCAGG + Intronic
1169046257 20:2536659-2536681 AGTCCACGTCCTGATCCTGCGGG + Intronic
1170571072 20:17632962-17632984 AGGCTGCGTCCACAGCCTGTGGG + Intronic
1170937305 20:20821543-20821565 AGGTTACACCCAGACCCTGAAGG - Intergenic
1174280117 20:49433175-49433197 AGGCTACCTACAGAACCTGAAGG + Intronic
1174487479 20:50870533-50870555 AGGCTTCGGCCAGACGCAGCAGG + Intronic
1175163914 20:57029644-57029666 CGGAGTCGTCCAGACCCTGCTGG - Intergenic
1175977400 20:62717965-62717987 AGGCCTCGTGCAGACCCTGCAGG + Intronic
1175986391 20:62766066-62766088 AGGCTACACCCAGAGCCTCCTGG + Intergenic
1176289949 21:5038421-5038443 AGGCTACGGCCAGACCCACCAGG - Intronic
1176448541 21:6841930-6841952 AGGCCACATCCAGCCCCTCCTGG - Intergenic
1176826711 21:13706952-13706974 AGGCCACATCCAGCCCCTCCTGG - Intergenic
1179867303 21:44225218-44225240 AGGCTACGGCCAGACCCACCAGG + Intronic
1180981820 22:19881924-19881946 AGGCTCCAGGCAGACCCTGCAGG - Intronic
1181530304 22:23513565-23513587 AGGCTGCTTCCAGACTCTGCCGG - Intergenic
1181847570 22:25724337-25724359 ACGCTAAGCCCAGACCCTGGTGG - Exonic
1183728897 22:39605946-39605968 AGGCAAGGTCCAGAGGCTGCAGG + Intronic
951315063 3:21179762-21179784 AGGCTACCTGCAGCCACTGCAGG + Intergenic
951546990 3:23836424-23836446 AGACTAGGTCCAGACTCTGTTGG + Intronic
951995905 3:28728376-28728398 AGGCAAAGTCCGGACCCTCCTGG + Intergenic
953971866 3:47354515-47354537 AGGCTACTTCCAACCCTTGCAGG - Intergenic
956745141 3:72305233-72305255 AGACTAAGTCGAGACCTTGCAGG + Intergenic
959648746 3:108731183-108731205 AGGCTCCTTCCAGTCTCTGCTGG - Intergenic
963115902 3:141728777-141728799 GGGCTACGTGCATACCCTGGAGG + Intergenic
968603713 4:1521819-1521841 AGGCCACGCCAAGCCCCTGCTGG + Intergenic
985511213 5:315271-315293 AGGCCACGTGCAGAGACTGCAGG - Intronic
991011107 5:61883879-61883901 AGACTATCTCCAGTCCCTGCAGG - Intergenic
1001313264 5:170626047-170626069 AGGCTGGAACCAGACCCTGCAGG + Intronic
1002185457 5:177452726-177452748 AGGCCACGCCCAGGACCTGCTGG - Intronic
1006361624 6:33590242-33590264 AGGCTCCACCCACACCCTGCAGG - Intergenic
1006883099 6:37356260-37356282 ATGCTACGACCTGACCTTGCAGG - Intronic
1007464794 6:42044178-42044200 AGGCTCCGGCCAGAACGTGCAGG - Intronic
1007581159 6:42960941-42960963 AGGCTACGTCGAGCACCCGCTGG - Exonic
1010792309 6:80078520-80078542 AGGCCACCAACAGACCCTGCAGG + Intergenic
1019625894 7:2015474-2015496 GTGCTGCCTCCAGACCCTGCGGG + Intronic
1026665974 7:72340118-72340140 TGGCTTCCTCCAGACCCTTCAGG - Intronic
1032519973 7:132536509-132536531 AGGCTTCCTTCAGCCCCTGCAGG + Intronic
1034136226 7:148772825-148772847 AGGCTACGTCCAGACCCTGCAGG - Intronic
1034550393 7:151816755-151816777 AGGCTAGTTCCAGAACCAGCAGG - Intronic
1035245320 7:157559280-157559302 ATCCTCCGTCCAGACCCTGAGGG - Intronic
1037448297 8:18990293-18990315 AAGCTAGGGCCAGACCATGCAGG - Intronic
1037734413 8:21555186-21555208 AGGCTCAGCCCAGACCCTTCTGG - Intergenic
1037946497 8:22992914-22992936 AGGCTACGCCTAGTCCCTGCTGG - Intronic
1041989333 8:63966985-63967007 AGGCTGAGTCCAGGCCCTCCTGG - Intergenic
1042573223 8:70190211-70190233 AGGCTAAGAACATACCCTGCAGG + Intronic
1045842615 8:106597347-106597369 AGGCTCCTTCCAGAACCTGCAGG + Intronic
1049098679 8:140563922-140563944 GAGCTACGACCAGACTCTGCGGG + Intronic
1049265169 8:141664042-141664064 AGGCCACATCCAGCCCCAGCAGG - Intergenic
1049807396 8:144547189-144547211 AGGCTTCCCCCAGATCCTGCTGG - Exonic
1050103583 9:2143315-2143337 AGGCTAGGGCCAGACCCTGGAGG + Intronic
1050160812 9:2717525-2717547 TGACTGCGTTCAGACCCTGCAGG + Exonic
1056526523 9:87447734-87447756 GGACTATCTCCAGACCCTGCTGG - Intergenic
1057929634 9:99182496-99182518 AGGCTACATCTTTACCCTGCCGG + Intergenic
1060870524 9:127036224-127036246 GGGCTATGTCCAGAAGCTGCTGG - Intronic
1061134952 9:128728516-128728538 AGGCCAGGTCCAGGCCCTGCAGG + Intergenic
1061250048 9:129421237-129421259 AGGCTACTTCCAGACTCTGTCGG + Intergenic
1061388728 9:130305579-130305601 AGGCTATGTCTAGGCTCTGCAGG + Intronic
1062191940 9:135252620-135252642 AGACTTCGTCAAGGCCCTGCCGG - Intergenic
1203520650 Un_GL000213v1:42588-42610 AGGCCACATCCAGCCCCTCCTGG + Intergenic
1185570935 X:1134289-1134311 AGCCTACGTGCATACCATGCAGG - Intergenic
1185869847 X:3655397-3655419 ATGCCACGTCCAGAACCTGCGGG + Exonic
1187297602 X:18017145-18017167 AGGCTGCTTCCAGCCCTTGCTGG - Intergenic
1193123352 X:77846691-77846713 AGGTTCCCTCCAGACCCTGTTGG + Intronic
1195762308 X:108259824-108259846 AGGCTACGTCCAAACTCAGCAGG + Intronic
1199556426 X:149114137-149114159 AGGCTGGGTCCAGCACCTGCTGG - Intergenic
1200794223 Y:7325899-7325921 ATGCCACGTCCAGAACCTGCAGG - Intergenic