ID: 1034144347

View in Genome Browser
Species Human (GRCh38)
Location 7:148855246-148855268
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034144342_1034144347 28 Left 1034144342 7:148855195-148855217 CCATGTTCTAGCTCAGCAGAGAG 0: 1
1: 0
2: 1
3: 18
4: 197
Right 1034144347 7:148855246-148855268 ACACACATGGGGCAAAGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr