ID: 1034145088

View in Genome Browser
Species Human (GRCh38)
Location 7:148863212-148863234
Sequence GTTCTCTGTGAGTCAAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 238}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034145088 Original CRISPR GTTCTCTGTGAGTCAAGAAA AGG (reversed) Intronic
902070484 1:13730982-13731004 GTGTTCTGCAAGTCAAGAAATGG - Exonic
902691888 1:18115160-18115182 CTGCTCTCTGAGCCAAGAAAGGG - Intronic
904671267 1:32167580-32167602 GTTCTCTGTTGGATAAGAAAAGG - Intronic
907126810 1:52057337-52057359 GTTCTCAAGGACTCAAGAAAGGG - Intronic
907181079 1:52570828-52570850 GTACTCTGTGAGTATAGAGAGGG + Intergenic
907287751 1:53392864-53392886 GTTGATTGTGTGTCAAGAAATGG + Intergenic
908710440 1:67008409-67008431 GGTCTCTGTGAGTTAAGAGTTGG - Intronic
909243562 1:73246488-73246510 GTTCTCTGTAACTTAAGACAGGG + Intergenic
909679952 1:78280627-78280649 GTTCTCAGAGAGAAAAGAAAGGG + Intergenic
909912509 1:81278333-81278355 GCTCTATGCCAGTCAAGAAATGG + Intergenic
910438170 1:87226557-87226579 ATTCTCAGGGAGTGAAGAAAGGG + Intergenic
912278889 1:108291627-108291649 GCTCTCTGTCAGCCAGGAAAAGG - Intergenic
912289337 1:108402730-108402752 GCTCTCTGTCAGCCAGGAAAAGG + Intronic
913177836 1:116291391-116291413 GTTCTGTGTGAGGCCGGAAAGGG - Intergenic
913348213 1:117829100-117829122 GCTCTCTGTGAACCAGGAAATGG - Intergenic
914325085 1:146605397-146605419 GCTTTCTGTGAGTCATAAAAGGG + Intergenic
914798674 1:150943243-150943265 TTTCTCTTTGAGGAAAGAAAAGG - Intronic
915863080 1:159468481-159468503 GTGCTCAGTGACTCAACAAAAGG - Intergenic
916638456 1:166699895-166699917 GTTCTTTGTGAGACAACAGAGGG + Intergenic
917085306 1:171298999-171299021 GCTTTCTGTGAGGGAAGAAATGG + Intergenic
918885999 1:190195603-190195625 TTTCTATGAGAGACAAGAAAAGG - Intronic
919661316 1:200250747-200250769 GTTTTCTGTGAGAGAAGGAAGGG - Intergenic
919939537 1:202276733-202276755 GTGCTCTGAGAGTCACTAAAGGG + Intronic
920585399 1:207154237-207154259 GTTCTCTGGGAGTAGGGAAAGGG - Intergenic
920841235 1:209555688-209555710 GGTGTGTGTGAGTGAAGAAAAGG + Intergenic
921794328 1:219325448-219325470 GGTCTTCATGAGTCAAGAAAGGG - Intergenic
923393255 1:233535051-233535073 GGTCTCTGAGAGTAAAGAACCGG + Intergenic
923904867 1:238372674-238372696 CCTCCCTGTGAGTCAAGAATGGG + Intergenic
924328393 1:242918801-242918823 GTGTTGTGTGAGTTAAGAAATGG + Intergenic
1065164548 10:22961314-22961336 ATTCTGTGTGAGTGAAGAAGTGG - Intronic
1067403952 10:46003514-46003536 GTACTCAGTGAGTCACCAAAGGG - Exonic
1069204494 10:65664567-65664589 GGTCTCTGTAAGTCATGATAAGG + Intergenic
1070777600 10:79118895-79118917 GTCCTATGGGAGACAAGAAAGGG - Exonic
1071937849 10:90550433-90550455 GTATTCTGTGAGTCCACAAATGG - Intergenic
1071950673 10:90699906-90699928 GCACTCTGTGAGTCCAGAGATGG + Intergenic
1072950560 10:99843453-99843475 GTTCTTTGTGAATCAGGGAAAGG - Intronic
1073866091 10:107805699-107805721 GTTCTCTCTGATTTTAGAAATGG - Intergenic
1080496113 11:32821625-32821647 GTTCTCTTTCAGTCATGAAAAGG - Intergenic
1081391107 11:42529908-42529930 GTTCTCTGTTATTAAAGAAAGGG - Intergenic
1083697997 11:64455450-64455472 CTTCTGTGTCACTCAAGAAATGG - Intergenic
1085211167 11:74780244-74780266 ATTCTTTGAGAGTCAAGAAAGGG - Intronic
1085672069 11:78476322-78476344 GTTCCCTGTGAGACAGGAATGGG + Intronic
1086921808 11:92595931-92595953 GTTCCAGGTTAGTCAAGAAAAGG - Intronic
1088438516 11:109841815-109841837 GTTGTCTGTGAATAAAGACAGGG - Intergenic
1090667001 11:128920929-128920951 GTTCTCTGGGAATCAGAAAAAGG - Exonic
1091352721 11:134910262-134910284 GTTGTCTGTGAAGCAAGTAAAGG + Intergenic
1091612606 12:2024093-2024115 GTTCACTTTGAGCCAAGAGAAGG - Intronic
1091709009 12:2724268-2724290 GTTTTCTGGGAGGAAAGAAAAGG + Intergenic
1091891293 12:4056657-4056679 ATTCTGTGTGAGCCAAGCAAGGG + Intergenic
1092118266 12:6025153-6025175 AATTTCTGTGAGACAAGAAATGG + Intronic
1092205236 12:6610800-6610822 AATCTCTGGGAGTCAGGAAAAGG - Intergenic
1092659437 12:10722834-10722856 GTTCTCGGTGAGTCAGGCCAGGG - Exonic
1093122755 12:15292456-15292478 GTTTTCTGTAAGTCTACAAATGG - Intronic
1093730516 12:22560945-22560967 GTTCTTTGGGAGGAAAGAAAAGG + Intergenic
1094174869 12:27530958-27530980 TTTCTCACAGAGTCAAGAAATGG - Intronic
1096032526 12:48433394-48433416 GTAAGTTGTGAGTCAAGAAATGG - Intergenic
1096340269 12:50792150-50792172 GTTCTGTGGGAGCAAAGAAAGGG - Intronic
1101222395 12:102655103-102655125 GGTCTCTGTGATTGCAGAAAAGG - Intergenic
1106127754 13:26914195-26914217 TTTCCCTGTGAGTCAAAGAAGGG - Intergenic
1106520938 13:30497185-30497207 GTTCAGTGTGAGTGAAGAGAGGG - Intronic
1106580529 13:31014346-31014368 GATCTCTTTTAGTCAATAAACGG - Intergenic
1107010359 13:35664311-35664333 GTTCTCTGAGAGACAAGATAGGG + Intronic
1108070448 13:46623652-46623674 TTATTCTTTGAGTCAAGAAAAGG - Intronic
1108075424 13:46674400-46674422 GCTCTTGTTGAGTCAAGAAAAGG - Intronic
1109187218 13:59284494-59284516 GTTCACTGTGAGACAAGTAGTGG + Intergenic
1109414885 13:62025975-62025997 TTGCTCTGTGAGTCAAAACAGGG + Intergenic
1109960976 13:69630244-69630266 GTTTTCAGTAATTCAAGAAATGG + Intergenic
1110203850 13:72887311-72887333 GTTCTCTGTAAGTTATGATATGG + Intronic
1110319817 13:74148704-74148726 GTTCTCTGGAAGGCAAGAGAAGG - Intergenic
1110967649 13:81720808-81720830 GCTCTCTGTTAGTTCAGAAAAGG - Intergenic
1111129700 13:83958769-83958791 GTTCCTTCTGAGCCAAGAAAGGG - Intergenic
1112082433 13:95988008-95988030 GTCCTCTGTGTATCAAGGAAGGG - Intronic
1116329692 14:43579794-43579816 CGTCTCTGTGAGTCATAAAAAGG + Intergenic
1119530536 14:75357247-75357269 GTTCCCTGTAAGAGAAGAAAGGG + Intergenic
1119979132 14:79059601-79059623 CTTCTCTGTGAGTCCAAACAAGG + Intronic
1122531042 14:102427189-102427211 GTTCTCTGTAACTGAGGAAAGGG - Intronic
1125353293 15:38790102-38790124 GTATCCTGTGAGTCTAGAAATGG - Intergenic
1125486198 15:40112520-40112542 TTTCTCTCTGAGACAAGAAATGG + Intergenic
1126427037 15:48538831-48538853 GATCCCTGTGAGTCTAAAAATGG + Intronic
1127071268 15:55289973-55289995 GTCCTCTGTGAGCCCCGAAAAGG + Intronic
1133439131 16:5805976-5805998 TCTCTCAGTGAGTCAATAAATGG + Intergenic
1133454302 16:5929858-5929880 GTCTTCTGAGAGTCCAGAAAAGG + Intergenic
1136560374 16:31035535-31035557 GTTTTCTGGGAGTCAAGATGAGG + Intronic
1137278076 16:46950552-46950574 GTCCTCTGTGAGTCAATATAAGG + Intergenic
1137288054 16:47032502-47032524 GTCCTCTGTGAGCCAATATAAGG - Intergenic
1137449067 16:48553946-48553968 GTTCCCTGTGACAGAAGAAAGGG + Intronic
1137812287 16:51364281-51364303 GGTCTCTGTGGGTCATGGAATGG + Intergenic
1138108868 16:54307446-54307468 GTGCTCTGTGGGTGAAGACAAGG + Intergenic
1138242335 16:55437095-55437117 GTTCTCTGTGTTTTAACAAAGGG + Intronic
1140008479 16:71105549-71105571 GCTTTCTGTGAGTCATAAAAGGG - Intronic
1140657421 16:77155158-77155180 GCACTCTGGGACTCAAGAAAAGG - Intergenic
1141853066 16:86660744-86660766 GTCCTCTTGGAGTCAGGAAATGG - Intergenic
1143449662 17:7028335-7028357 GTTCTCTAGCAGTCTAGAAATGG + Exonic
1143593802 17:7902069-7902091 GTTCTCTGAGACCCATGAAAAGG - Intronic
1146744990 17:35320418-35320440 GCTGTCTGTGAGTCAGGAATTGG + Intergenic
1147451853 17:40510584-40510606 GTTAACTGTGAGTTAATAAATGG + Intergenic
1147677761 17:42219486-42219508 GTTCTCTGGGAGCCCAGAAGGGG - Intronic
1147688275 17:42300085-42300107 GTTCTCTGGGAGCCCAGAAGGGG + Intronic
1147898280 17:43766852-43766874 GTGCTCTGTCAGTCAAAGAAAGG + Exonic
1148231898 17:45941434-45941456 GGTCTCTGAGAGTCATTAAAGGG - Intronic
1149161004 17:53692902-53692924 GATCTCTGTGTGTAATGAAAAGG - Intergenic
1150176778 17:63066028-63066050 GTTGTCTGTGAGTCAAGTCTTGG + Intronic
1154075460 18:11196081-11196103 GTTCCCTGAGAGTCAGGAACAGG - Intergenic
1154957540 18:21274142-21274164 ATCATCTGTGAATCAAGAAATGG - Intronic
1155022690 18:21910974-21910996 GGTCGCTCTGAGTCTAGAAATGG + Intergenic
1155352634 18:24921875-24921897 GTTCGCAGTGAGTTAGGAAAGGG - Intergenic
1156209225 18:34920631-34920653 GGTCTCTGTGAGGTTAGAAATGG - Intergenic
1162287821 19:9753015-9753037 GCTCTCTGTGAACCAGGAAAAGG - Intronic
1162962371 19:14135909-14135931 GATCTCCGTGGGTTAAGAAATGG + Intronic
1165282946 19:34813849-34813871 TTTCTCTGTGAGTCACGTGAGGG - Intergenic
1166379444 19:42348217-42348239 GTGGCCTGTGAGTCCAGAAAGGG + Intronic
1166546713 19:43638695-43638717 CTTCTCTGTGAGTCAAGCCTGGG + Intronic
1167423896 19:49419838-49419860 GTCCTGTGAGAGTCCAGAAAAGG + Intergenic
1167981190 19:53277019-53277041 GCTCACTGTGAGTCCAGGAATGG - Intergenic
925648927 2:6068196-6068218 GTTTGCTGTGAATCAAGTAAAGG - Intergenic
928376067 2:30775871-30775893 GTTCTCTGTGAGTACAGGGAAGG - Intronic
928588245 2:32785013-32785035 GTTCTCTTAGAGTCAATAGATGG + Intronic
929680644 2:43990323-43990345 GTTCTCTTTCTCTCAAGAAACGG + Intronic
930686208 2:54311273-54311295 GATCTCTGTGAAACAAGAGAAGG + Intergenic
930932747 2:56907409-56907431 TTTCTCTGTGAGGTAAAAAAAGG - Intergenic
936091264 2:109502775-109502797 GTTCTCTCTGAGGCAATAAAGGG - Intronic
939489034 2:142854727-142854749 GTTCTCTCTGATTGAACAAATGG - Intergenic
939869522 2:147511409-147511431 GTGCTCTGAGAGATAAGAAAAGG + Intergenic
942347250 2:175016304-175016326 GTTCTCTGAGTGTTAAAAAAGGG - Intergenic
942357751 2:175137308-175137330 GTTGAATGTGAGTGAAGAAATGG - Intronic
942829382 2:180221623-180221645 CATCTTTGTGAGTCAGGAAATGG + Intergenic
944007294 2:194925177-194925199 GTTCTTTGTTAGAAAAGAAATGG + Intergenic
946593422 2:221277569-221277591 GTTCTGTGTGATTCTACAAATGG + Intergenic
946896173 2:224326797-224326819 GCTCTCTGTGACACAAGAGAGGG - Intergenic
946956060 2:224931237-224931259 GTGCTCTGTGAGTCCAGGTAAGG + Intronic
947936586 2:234009730-234009752 ATTCTCTGTGAGTAAAAAGAAGG - Intronic
1169030469 20:2402874-2402896 GTCCTAAGTGAGACAAGAAAAGG - Intronic
1172475670 20:35235771-35235793 CTTCTTGGTGAGTTAAGAAAAGG - Intronic
1172948288 20:38705204-38705226 GTTCTCTGTGGCCCAAGACAGGG + Intergenic
1173207369 20:41005654-41005676 GTCTTCTGTAAGTCAAGAGAAGG + Intergenic
1173243923 20:41321098-41321120 CACCTCTGTGAATCAAGAAATGG + Intergenic
1175238649 20:57529794-57529816 GTTTTGTGTGAGCCAAGAAGGGG + Intergenic
1176893220 21:14344517-14344539 GTCCACTGTGGGTCAGGAAAGGG + Intergenic
1179348297 21:40582353-40582375 ATTTTCTGTGAGTCCAAAAATGG + Intronic
1179806995 21:43845663-43845685 AGTCTCTGTGAGTCAAGAGCGGG - Intergenic
1180569700 22:16703565-16703587 AATTTCTGTGAGACAAGAAATGG + Intergenic
1182181283 22:28351312-28351334 GTTTTATGTGTGTAAAGAAATGG + Intronic
1183858184 22:40650604-40650626 GCTCTCTGTGGGTCCAGCAAGGG + Intergenic
1185149640 22:49156753-49156775 TTTCTCTGTGATTCAACACACGG + Intergenic
949343756 3:3057576-3057598 GTTCTCTGAGAAAGAAGAAAAGG - Exonic
949455357 3:4232431-4232453 GTCCCCTGTGAGCCAAGAGAAGG + Intronic
949891691 3:8738082-8738104 CCTATGTGTGAGTCAAGAAAGGG - Intronic
951836100 3:26985059-26985081 GTTCTCTCTGCATCAAGGAATGG + Intergenic
951847554 3:27101152-27101174 GTTGTCTGTGATAGAAGAAAAGG - Intergenic
953116072 3:39993648-39993670 TTTCTCAGTGAATTAAGAAAAGG - Intronic
957560473 3:81814501-81814523 GATCTCTGTCATTCAACAAAAGG - Intergenic
957606622 3:82407674-82407696 TTGCTCTGTGAGTAAACAAAAGG - Intergenic
959490714 3:106985225-106985247 GTCCTCTGTGGACCAAGAAAGGG + Intergenic
960171019 3:114461144-114461166 GGTCTCTGGCACTCAAGAAATGG - Intronic
960965657 3:123102862-123102884 TTTCTCTCTGAGAAAAGAAAGGG + Intronic
962355760 3:134693052-134693074 GGTCTCTGTTAATTAAGAAAAGG - Intronic
962802194 3:138899901-138899923 GTCCTCTATGAGTTAAGCAAGGG + Intergenic
965122037 3:164572487-164572509 GATCTCTGTAAGTCAGGAAATGG - Intergenic
965343764 3:167521587-167521609 GTTCAATGTGAGAAAAGAAATGG - Intronic
968015781 3:195331392-195331414 GTTCTCAGTGAGCCAAGATCGGG - Intronic
972520181 4:39847161-39847183 GTTATCTATGAGTCCAGATAAGG + Intronic
973215508 4:47664983-47665005 GTTCTCTCTGAGGCAAAATAAGG + Intronic
974917109 4:68192402-68192424 GTTCTATGTGAATGCAGAAAAGG + Intergenic
975224975 4:71860818-71860840 GTTCTATGTAAGTCATAAAAAGG - Intergenic
976541018 4:86276364-86276386 TTTCTCTGTGAGTGATGAGATGG - Intronic
976563741 4:86530609-86530631 ATTTTTTGTGAATCAAGAAATGG - Intronic
977432288 4:96945086-96945108 GTTGTTTCTGAGTCAGGAAAGGG - Intergenic
978290983 4:107140227-107140249 GTTTTATTTGAGTCAAAAAATGG + Intronic
978861292 4:113452252-113452274 GTTCTCTGTGAGCAAAACAATGG - Intronic
980466610 4:133194439-133194461 GTTATCTGTGAGTGAAAACAGGG + Exonic
981031334 4:140128592-140128614 GCACTCTGTGTGTCAAAAAAGGG + Intronic
981757663 4:148158420-148158442 GTTCTCTGAGAGATAAGAGAGGG - Intronic
982117995 4:152113663-152113685 TTTGCCTGTGAATCAAGAAAAGG + Intergenic
983186072 4:164701654-164701676 GTTCTGTGGGAGGCAAGACATGG + Intergenic
983238102 4:165202976-165202998 TTTCTCTGTGTTTTAAGAAAAGG - Intronic
984360314 4:178721544-178721566 GTTATATGAGAGTCAAGAACAGG - Intergenic
984438721 4:179737984-179738006 GTAATCTTTGAGTCAATAAAGGG - Intergenic
986135191 5:4970513-4970535 GTTCTATGAGAGTCAAGTCAGGG + Intergenic
986431841 5:7688904-7688926 GGCCTCTGTGACTCATGAAATGG - Intronic
986935780 5:12884412-12884434 ATTCTCAGTGGGCCAAGAAATGG + Intergenic
987257139 5:16167449-16167471 GTTCTCTCTCAGTCAAGGGAAGG + Intronic
987719953 5:21620195-21620217 GTTCTTTATGAATCAATAAAAGG + Intergenic
989519884 5:42389326-42389348 ATTTTCTATGAGTCAATAAATGG - Intergenic
993431888 5:87841895-87841917 GTTGGCTGGGAGCCAAGAAAGGG - Intergenic
993993449 5:94688590-94688612 GTTCTCTGAGAGTCAAAACAAGG - Exonic
994216327 5:97142516-97142538 GATCTCTGTGAGGCAAGACTTGG + Exonic
996016307 5:118537756-118537778 TTCATCTGTGAGTCAAGAAAGGG + Intergenic
996658420 5:125969243-125969265 GTTCCCAGTGGGTCAAAAAAAGG - Intergenic
999283689 5:150381428-150381450 GGTCTCTGAGAGGCCAGAAAAGG + Intronic
999354043 5:150906911-150906933 AGTTTCTGTGAGTCAAGAATGGG + Intergenic
999613732 5:153399660-153399682 GAACTCTGTGAGTCCATAAAAGG + Intergenic
1000673405 5:164090430-164090452 GTTTTTTGAGAGTCAATAAATGG + Intergenic
1002560158 5:180075859-180075881 GTTCCCTATGGGTCAAGGAATGG - Intergenic
1002969042 6:1995482-1995504 GTTCTCTCTGAGACAACACAGGG - Intronic
1005199939 6:23333441-23333463 GTTGTGTGTGTGTCAGGAAACGG - Intergenic
1007325545 6:41056798-41056820 GCTCTCTGTCAGACAAGACAGGG + Intronic
1008063817 6:47026581-47026603 CTTCTCTGTGGGGAAAGAAAAGG - Intronic
1010731939 6:79400326-79400348 GTTATTTGTGAGTCAGAAAAAGG + Intergenic
1010843482 6:80676811-80676833 GTTCTCTCTCTGTAAAGAAAAGG + Intergenic
1012592459 6:100999074-100999096 GCTCTCTATGAGGCAAGGAAAGG + Intergenic
1012726680 6:102822256-102822278 GGACTCTGTGACTAAAGAAAAGG + Intergenic
1018503485 6:164439092-164439114 GTTGTCTGTGAGACAATCAAAGG - Intergenic
1021277757 7:18675787-18675809 CTTCCCTGTAAGTCATGAAAGGG - Intronic
1022828298 7:34039088-34039110 GTTCTCAGTGAGAGAAGAACAGG - Intronic
1023130718 7:37000277-37000299 GTGCTCTGTGATTCACAAAATGG + Intronic
1025009855 7:55387738-55387760 GGTCTGTGTAAGTCATGAAAAGG - Intronic
1029977020 7:104844257-104844279 GTTCTCTGTGAGGCACCAGATGG + Intronic
1031027726 7:116698656-116698678 TTTCTCTGTTAGTCAAGTAAAGG - Intronic
1033941376 7:146659159-146659181 ATTCTCAGTGATTAAAGAAAAGG + Intronic
1034004432 7:147453432-147453454 GATCTCCTTGAGTCAGGAAATGG + Intronic
1034145088 7:148863212-148863234 GTTCTCTGTGAGTCAAGAAAAGG - Intronic
1034504173 7:151472858-151472880 GCTCGCTGTGGGTCAACAAATGG + Intronic
1034735936 7:153429638-153429660 GTCCTCTGTGATTCATGAAAGGG - Intergenic
1036243024 8:7094822-7094844 GTGGCCTGTGAGTGAAGAAACGG - Intergenic
1036732447 8:11277693-11277715 GTTCTCTGTGCCTCAATAAAAGG + Intergenic
1039111171 8:34041953-34041975 GTTCTCCCTGACTCCAGAAAAGG - Intergenic
1039193645 8:35005500-35005522 TTTCTCTGAGCCTCAAGAAATGG + Intergenic
1039376006 8:37034864-37034886 TTTCTCTCTGGGTCAAGGAAGGG - Intergenic
1039767304 8:40642913-40642935 GTTTTCTCTGAGTAAAAAAAGGG + Intronic
1041412762 8:57574940-57574962 TTTCTCTGTGAGTAAGGACAAGG + Intergenic
1041506290 8:58601648-58601670 TTTCTCTGTTAGATAAGAAAAGG + Intronic
1043989456 8:86734603-86734625 GTTCCCAGTGATTTAAGAAAGGG + Intronic
1044517053 8:93151845-93151867 GTGCTTTGGAAGTCAAGAAAAGG + Intronic
1044549242 8:93494048-93494070 CTTAGCTGTGAATCAAGAAATGG - Intergenic
1044632984 8:94297276-94297298 GTATTCTGTGAGTCCAGAGATGG + Intergenic
1046104559 8:109649964-109649986 GTTATCTGTAAGACATGAAAAGG + Intronic
1046378387 8:113418934-113418956 ATTCTCTGTAAGTCTAGAATTGG - Intronic
1046797121 8:118385318-118385340 ATTCTCTCTTAGTCTAGAAAGGG - Intronic
1046815754 8:118581865-118581887 CTTCTCTGTGAATAAAGGAAAGG - Intronic
1047249620 8:123171827-123171849 GTTTGCTGTGGGTGAAGAAACGG + Intergenic
1048000019 8:130371422-130371444 GGGCTCTGTTAGTGAAGAAACGG - Intronic
1049053372 8:140216484-140216506 GTACTCTGTTAGACAAGAAGAGG - Intronic
1050240839 9:3632829-3632851 ATTCTCTGTGAGGGAAGTAAAGG - Intergenic
1051177365 9:14374494-14374516 GGTTTCTGTGAGTTGAGAAATGG + Intronic
1051585591 9:18723537-18723559 CTTGTCTGTGAGTCAACAAAAGG - Intronic
1052488220 9:29129933-29129955 GGTCTGTGTAAGTCATGAAAAGG + Intergenic
1054716779 9:68564549-68564571 GCTCTCTGTGAGTCAAGCCTTGG - Intergenic
1055789733 9:79911077-79911099 GTTTTATGAGAGGCAAGAAATGG + Intergenic
1056084992 9:83139016-83139038 GCTCTCTGTAAGTCTGGAAATGG + Intergenic
1056433954 9:86557205-86557227 AAACTCTGTGAGTCAAGCAAAGG + Intergenic
1056842747 9:90011723-90011745 GTTTTCTGAGTGTCAAGAGAAGG + Intergenic
1057066132 9:92053801-92053823 CTTCTTCGTGAGTCATGAAAAGG + Intronic
1057404582 9:94757145-94757167 GTTCCCTCTGAATCAAGAGAAGG + Intronic
1059362672 9:113757730-113757752 GTCATCTGTGAGTCAGAAAATGG - Intergenic
1059394983 9:114028603-114028625 GTTCTCTGTGGCACAAGAAGAGG + Intronic
1061467039 9:130789119-130789141 GTTCTCTTAGAGTGGAGAAAGGG + Intronic
1186127863 X:6433790-6433812 GACCTCTCTGAGTCAAGAATTGG + Intergenic
1186975523 X:14898884-14898906 ATTCTTTGTGACTCATGAAAGGG - Intronic
1188793291 X:34431737-34431759 CTTCTCTGTAATTCAAAAAAGGG + Intergenic
1190223325 X:48527275-48527297 GGTCTCTGTGGGTAAGGAAAGGG + Exonic
1190713605 X:53086715-53086737 GTGCTCTCTGAGTCCAGAAAAGG + Intronic
1191801540 X:65086672-65086694 GTTGTCTGTGAGCCAGGAAGTGG + Intergenic
1192751223 X:73994027-73994049 GTTCTGTGAGGGTAAAGAAAAGG - Intergenic
1194775105 X:97953688-97953710 GTTTTCTTTGTGTCAAGAGATGG + Intergenic
1201225776 Y:11817758-11817780 GTGTTCTGTGAGTTAAGAAATGG + Intergenic
1201615567 Y:15894174-15894196 GTTCTCAGTGAGTCAGGATAAGG - Intergenic