ID: 1034147025

View in Genome Browser
Species Human (GRCh38)
Location 7:148883491-148883513
Sequence GCGGGACGACGTTCGCGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 28
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 25}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034147025_1034147040 14 Left 1034147025 7:148883491-148883513 CCCCGCCGCGAACGTCGTCCCGC 0: 1
1: 0
2: 0
3: 2
4: 25
Right 1034147040 7:148883528-148883550 CAGCCCGGGGTCGGCGCGCCCGG No data
1034147025_1034147036 5 Left 1034147025 7:148883491-148883513 CCCCGCCGCGAACGTCGTCCCGC 0: 1
1: 0
2: 0
3: 2
4: 25
Right 1034147036 7:148883519-148883541 CCGCGGCCCCAGCCCGGGGTCGG 0: 1
1: 0
2: 1
3: 32
4: 313
1034147025_1034147033 0 Left 1034147025 7:148883491-148883513 CCCCGCCGCGAACGTCGTCCCGC 0: 1
1: 0
2: 0
3: 2
4: 25
Right 1034147033 7:148883514-148883536 GAGCGCCGCGGCCCCAGCCCGGG 0: 1
1: 0
2: 4
3: 50
4: 470
1034147025_1034147047 23 Left 1034147025 7:148883491-148883513 CCCCGCCGCGAACGTCGTCCCGC 0: 1
1: 0
2: 0
3: 2
4: 25
Right 1034147047 7:148883537-148883559 GTCGGCGCGCCCGGGACCGGGGG 0: 1
1: 0
2: 1
3: 10
4: 118
1034147025_1034147032 -1 Left 1034147025 7:148883491-148883513 CCCCGCCGCGAACGTCGTCCCGC 0: 1
1: 0
2: 0
3: 2
4: 25
Right 1034147032 7:148883513-148883535 CGAGCGCCGCGGCCCCAGCCCGG 0: 1
1: 0
2: 2
3: 55
4: 342
1034147025_1034147044 20 Left 1034147025 7:148883491-148883513 CCCCGCCGCGAACGTCGTCCCGC 0: 1
1: 0
2: 0
3: 2
4: 25
Right 1034147044 7:148883534-148883556 GGGGTCGGCGCGCCCGGGACCGG 0: 1
1: 0
2: 3
3: 17
4: 197
1034147025_1034147046 22 Left 1034147025 7:148883491-148883513 CCCCGCCGCGAACGTCGTCCCGC 0: 1
1: 0
2: 0
3: 2
4: 25
Right 1034147046 7:148883536-148883558 GGTCGGCGCGCCCGGGACCGGGG 0: 1
1: 0
2: 2
3: 12
4: 139
1034147025_1034147034 1 Left 1034147025 7:148883491-148883513 CCCCGCCGCGAACGTCGTCCCGC 0: 1
1: 0
2: 0
3: 2
4: 25
Right 1034147034 7:148883515-148883537 AGCGCCGCGGCCCCAGCCCGGGG No data
1034147025_1034147041 15 Left 1034147025 7:148883491-148883513 CCCCGCCGCGAACGTCGTCCCGC 0: 1
1: 0
2: 0
3: 2
4: 25
Right 1034147041 7:148883529-148883551 AGCCCGGGGTCGGCGCGCCCGGG 0: 1
1: 0
2: 1
3: 21
4: 203
1034147025_1034147045 21 Left 1034147025 7:148883491-148883513 CCCCGCCGCGAACGTCGTCCCGC 0: 1
1: 0
2: 0
3: 2
4: 25
Right 1034147045 7:148883535-148883557 GGGTCGGCGCGCCCGGGACCGGG 0: 1
1: 0
2: 1
3: 16
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034147025 Original CRISPR GCGGGACGACGTTCGCGGCG GGG (reversed) Intronic