ID: 1034147308

View in Genome Browser
Species Human (GRCh38)
Location 7:148884393-148884415
Sequence TCGGCGCCTCCGAGCCCGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 109}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034147308_1034147322 20 Left 1034147308 7:148884393-148884415 CCCGCCGGGCTCGGAGGCGCCGA 0: 1
1: 0
2: 0
3: 13
4: 109
Right 1034147322 7:148884436-148884458 GCTCAGGGCTCGTGGGCGGGCGG 0: 1
1: 0
2: 3
3: 16
4: 250
1034147308_1034147323 21 Left 1034147308 7:148884393-148884415 CCCGCCGGGCTCGGAGGCGCCGA 0: 1
1: 0
2: 0
3: 13
4: 109
Right 1034147323 7:148884437-148884459 CTCAGGGCTCGTGGGCGGGCGGG 0: 1
1: 0
2: 1
3: 27
4: 209
1034147308_1034147318 12 Left 1034147308 7:148884393-148884415 CCCGCCGGGCTCGGAGGCGCCGA 0: 1
1: 0
2: 0
3: 13
4: 109
Right 1034147318 7:148884428-148884450 CAGAGTGCGCTCAGGGCTCGTGG 0: 1
1: 0
2: 1
3: 6
4: 137
1034147308_1034147320 16 Left 1034147308 7:148884393-148884415 CCCGCCGGGCTCGGAGGCGCCGA 0: 1
1: 0
2: 0
3: 13
4: 109
Right 1034147320 7:148884432-148884454 GTGCGCTCAGGGCTCGTGGGCGG 0: 1
1: 0
2: 1
3: 13
4: 139
1034147308_1034147321 17 Left 1034147308 7:148884393-148884415 CCCGCCGGGCTCGGAGGCGCCGA 0: 1
1: 0
2: 0
3: 13
4: 109
Right 1034147321 7:148884433-148884455 TGCGCTCAGGGCTCGTGGGCGGG 0: 1
1: 0
2: 1
3: 13
4: 180
1034147308_1034147313 4 Left 1034147308 7:148884393-148884415 CCCGCCGGGCTCGGAGGCGCCGA 0: 1
1: 0
2: 0
3: 13
4: 109
Right 1034147313 7:148884420-148884442 GCCCCACGCAGAGTGCGCTCAGG 0: 1
1: 0
2: 2
3: 11
4: 155
1034147308_1034147324 27 Left 1034147308 7:148884393-148884415 CCCGCCGGGCTCGGAGGCGCCGA 0: 1
1: 0
2: 0
3: 13
4: 109
Right 1034147324 7:148884443-148884465 GCTCGTGGGCGGGCGGGCACTGG 0: 1
1: 0
2: 0
3: 10
4: 194
1034147308_1034147319 13 Left 1034147308 7:148884393-148884415 CCCGCCGGGCTCGGAGGCGCCGA 0: 1
1: 0
2: 0
3: 13
4: 109
Right 1034147319 7:148884429-148884451 AGAGTGCGCTCAGGGCTCGTGGG 0: 1
1: 0
2: 0
3: 6
4: 66
1034147308_1034147315 5 Left 1034147308 7:148884393-148884415 CCCGCCGGGCTCGGAGGCGCCGA 0: 1
1: 0
2: 0
3: 13
4: 109
Right 1034147315 7:148884421-148884443 CCCCACGCAGAGTGCGCTCAGGG 0: 1
1: 0
2: 1
3: 4
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034147308 Original CRISPR TCGGCGCCTCCGAGCCCGGC GGG (reversed) Intergenic