ID: 1034147311

View in Genome Browser
Species Human (GRCh38)
Location 7:148884412-148884434
Sequence CACTCTGCGTGGGGCTGGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 234}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034147311_1034147323 2 Left 1034147311 7:148884412-148884434 CCGAGCCAGCCCCACGCAGAGTG 0: 1
1: 0
2: 0
3: 21
4: 234
Right 1034147323 7:148884437-148884459 CTCAGGGCTCGTGGGCGGGCGGG 0: 1
1: 0
2: 1
3: 27
4: 209
1034147311_1034147321 -2 Left 1034147311 7:148884412-148884434 CCGAGCCAGCCCCACGCAGAGTG 0: 1
1: 0
2: 0
3: 21
4: 234
Right 1034147321 7:148884433-148884455 TGCGCTCAGGGCTCGTGGGCGGG 0: 1
1: 0
2: 1
3: 13
4: 180
1034147311_1034147324 8 Left 1034147311 7:148884412-148884434 CCGAGCCAGCCCCACGCAGAGTG 0: 1
1: 0
2: 0
3: 21
4: 234
Right 1034147324 7:148884443-148884465 GCTCGTGGGCGGGCGGGCACTGG 0: 1
1: 0
2: 0
3: 10
4: 194
1034147311_1034147319 -6 Left 1034147311 7:148884412-148884434 CCGAGCCAGCCCCACGCAGAGTG 0: 1
1: 0
2: 0
3: 21
4: 234
Right 1034147319 7:148884429-148884451 AGAGTGCGCTCAGGGCTCGTGGG 0: 1
1: 0
2: 0
3: 6
4: 66
1034147311_1034147325 26 Left 1034147311 7:148884412-148884434 CCGAGCCAGCCCCACGCAGAGTG 0: 1
1: 0
2: 0
3: 21
4: 234
Right 1034147325 7:148884461-148884483 ACTGGCAGCGCGTGCGCGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 46
1034147311_1034147322 1 Left 1034147311 7:148884412-148884434 CCGAGCCAGCCCCACGCAGAGTG 0: 1
1: 0
2: 0
3: 21
4: 234
Right 1034147322 7:148884436-148884458 GCTCAGGGCTCGTGGGCGGGCGG 0: 1
1: 0
2: 3
3: 16
4: 250
1034147311_1034147318 -7 Left 1034147311 7:148884412-148884434 CCGAGCCAGCCCCACGCAGAGTG 0: 1
1: 0
2: 0
3: 21
4: 234
Right 1034147318 7:148884428-148884450 CAGAGTGCGCTCAGGGCTCGTGG 0: 1
1: 0
2: 1
3: 6
4: 137
1034147311_1034147326 27 Left 1034147311 7:148884412-148884434 CCGAGCCAGCCCCACGCAGAGTG 0: 1
1: 0
2: 0
3: 21
4: 234
Right 1034147326 7:148884462-148884484 CTGGCAGCGCGTGCGCGCGCGGG 0: 1
1: 0
2: 0
3: 7
4: 116
1034147311_1034147320 -3 Left 1034147311 7:148884412-148884434 CCGAGCCAGCCCCACGCAGAGTG 0: 1
1: 0
2: 0
3: 21
4: 234
Right 1034147320 7:148884432-148884454 GTGCGCTCAGGGCTCGTGGGCGG 0: 1
1: 0
2: 1
3: 13
4: 139
1034147311_1034147327 30 Left 1034147311 7:148884412-148884434 CCGAGCCAGCCCCACGCAGAGTG 0: 1
1: 0
2: 0
3: 21
4: 234
Right 1034147327 7:148884465-148884487 GCAGCGCGTGCGCGCGCGGGCGG 0: 1
1: 0
2: 3
3: 27
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034147311 Original CRISPR CACTCTGCGTGGGGCTGGCT CGG (reversed) Intergenic