ID: 1034147317

View in Genome Browser
Species Human (GRCh38)
Location 7:148884423-148884445
Sequence AGCCCTGAGCGCACTCTGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 97}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034147317_1034147325 15 Left 1034147317 7:148884423-148884445 CCACGCAGAGTGCGCTCAGGGCT 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1034147325 7:148884461-148884483 ACTGGCAGCGCGTGCGCGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 46
1034147317_1034147331 27 Left 1034147317 7:148884423-148884445 CCACGCAGAGTGCGCTCAGGGCT 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1034147331 7:148884473-148884495 TGCGCGCGCGGGCGGCGGCGGGG 0: 1
1: 1
2: 20
3: 99
4: 620
1034147317_1034147322 -10 Left 1034147317 7:148884423-148884445 CCACGCAGAGTGCGCTCAGGGCT 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1034147322 7:148884436-148884458 GCTCAGGGCTCGTGGGCGGGCGG 0: 1
1: 0
2: 3
3: 16
4: 250
1034147317_1034147326 16 Left 1034147317 7:148884423-148884445 CCACGCAGAGTGCGCTCAGGGCT 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1034147326 7:148884462-148884484 CTGGCAGCGCGTGCGCGCGCGGG 0: 1
1: 0
2: 0
3: 7
4: 116
1034147317_1034147330 26 Left 1034147317 7:148884423-148884445 CCACGCAGAGTGCGCTCAGGGCT 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1034147330 7:148884472-148884494 GTGCGCGCGCGGGCGGCGGCGGG 0: 1
1: 1
2: 10
3: 104
4: 538
1034147317_1034147328 22 Left 1034147317 7:148884423-148884445 CCACGCAGAGTGCGCTCAGGGCT 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1034147328 7:148884468-148884490 GCGCGTGCGCGCGCGGGCGGCGG 0: 1
1: 0
2: 15
3: 94
4: 571
1034147317_1034147323 -9 Left 1034147317 7:148884423-148884445 CCACGCAGAGTGCGCTCAGGGCT 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1034147323 7:148884437-148884459 CTCAGGGCTCGTGGGCGGGCGGG 0: 1
1: 0
2: 1
3: 27
4: 209
1034147317_1034147327 19 Left 1034147317 7:148884423-148884445 CCACGCAGAGTGCGCTCAGGGCT 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1034147327 7:148884465-148884487 GCAGCGCGTGCGCGCGCGGGCGG 0: 1
1: 0
2: 3
3: 27
4: 218
1034147317_1034147329 25 Left 1034147317 7:148884423-148884445 CCACGCAGAGTGCGCTCAGGGCT 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1034147329 7:148884471-148884493 CGTGCGCGCGCGGGCGGCGGCGG 0: 1
1: 1
2: 8
3: 93
4: 611
1034147317_1034147324 -3 Left 1034147317 7:148884423-148884445 CCACGCAGAGTGCGCTCAGGGCT 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1034147324 7:148884443-148884465 GCTCGTGGGCGGGCGGGCACTGG 0: 1
1: 0
2: 0
3: 10
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034147317 Original CRISPR AGCCCTGAGCGCACTCTGCG TGG (reversed) Intergenic