ID: 1034147324

View in Genome Browser
Species Human (GRCh38)
Location 7:148884443-148884465
Sequence GCTCGTGGGCGGGCGGGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 194}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034147312_1034147324 3 Left 1034147312 7:148884417-148884439 CCAGCCCCACGCAGAGTGCGCTC 0: 1
1: 0
2: 0
3: 5
4: 103
Right 1034147324 7:148884443-148884465 GCTCGTGGGCGGGCGGGCACTGG 0: 1
1: 0
2: 0
3: 10
4: 194
1034147317_1034147324 -3 Left 1034147317 7:148884423-148884445 CCACGCAGAGTGCGCTCAGGGCT 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1034147324 7:148884443-148884465 GCTCGTGGGCGGGCGGGCACTGG 0: 1
1: 0
2: 0
3: 10
4: 194
1034147314_1034147324 -1 Left 1034147314 7:148884421-148884443 CCCCACGCAGAGTGCGCTCAGGG 0: 1
1: 0
2: 2
3: 5
4: 151
Right 1034147324 7:148884443-148884465 GCTCGTGGGCGGGCGGGCACTGG 0: 1
1: 0
2: 0
3: 10
4: 194
1034147310_1034147324 23 Left 1034147310 7:148884397-148884419 CCGGGCTCGGAGGCGCCGAGCCA 0: 1
1: 0
2: 0
3: 10
4: 112
Right 1034147324 7:148884443-148884465 GCTCGTGGGCGGGCGGGCACTGG 0: 1
1: 0
2: 0
3: 10
4: 194
1034147308_1034147324 27 Left 1034147308 7:148884393-148884415 CCCGCCGGGCTCGGAGGCGCCGA 0: 1
1: 0
2: 0
3: 13
4: 109
Right 1034147324 7:148884443-148884465 GCTCGTGGGCGGGCGGGCACTGG 0: 1
1: 0
2: 0
3: 10
4: 194
1034147316_1034147324 -2 Left 1034147316 7:148884422-148884444 CCCACGCAGAGTGCGCTCAGGGC 0: 1
1: 0
2: 0
3: 2
4: 76
Right 1034147324 7:148884443-148884465 GCTCGTGGGCGGGCGGGCACTGG 0: 1
1: 0
2: 0
3: 10
4: 194
1034147311_1034147324 8 Left 1034147311 7:148884412-148884434 CCGAGCCAGCCCCACGCAGAGTG 0: 1
1: 0
2: 0
3: 21
4: 234
Right 1034147324 7:148884443-148884465 GCTCGTGGGCGGGCGGGCACTGG 0: 1
1: 0
2: 0
3: 10
4: 194
1034147309_1034147324 26 Left 1034147309 7:148884394-148884416 CCGCCGGGCTCGGAGGCGCCGAG 0: 1
1: 0
2: 1
3: 5
4: 93
Right 1034147324 7:148884443-148884465 GCTCGTGGGCGGGCGGGCACTGG 0: 1
1: 0
2: 0
3: 10
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034147324 Original CRISPR GCTCGTGGGCGGGCGGGCAC TGG Intergenic
900617929 1:3573662-3573684 GCTCCTGGAAGGGCGGGCTCTGG - Intronic
902831436 1:19015867-19015889 GCTGGGGGGCAGGAGGGCACAGG - Intergenic
903413829 1:23168285-23168307 GCGCGGGGCCCGGCGGGCACCGG - Intronic
903724494 1:25430870-25430892 GGTGCTGGGCGGGCGGGCCCCGG + Intronic
906581825 1:46941259-46941281 GCCAGTGGGAGGGAGGGCACGGG + Exonic
906601892 1:47137638-47137660 GCCAGTGGGAGGGAGGGCACGGG - Exonic
907429910 1:54405865-54405887 GCAGGTGGGCGGGCGGGCGGGGG - Intronic
907451455 1:54548174-54548196 TCTGGTGGGCGGGCGGGAGCTGG + Intronic
917141631 1:171841455-171841477 GCGCCTGCGCGGGCGGGCAGGGG - Intergenic
919712264 1:200739540-200739562 GCTCGGAGGGGCGCGGGCACGGG + Exonic
922602991 1:226870952-226870974 GCTCGGCGGCAGGCGGGCGCAGG - Intronic
922958555 1:229625809-229625831 GCGCGCGGGCGGGCGGGGGCCGG - Intronic
923052298 1:230397126-230397148 GCGCGTGTGCGGGTGGGCAATGG - Intronic
1062855016 10:775721-775743 GCTGGGGGCCGGGCAGGCACCGG + Intergenic
1064022795 10:11823333-11823355 GCGCGCGGGTGGGCGCGCACAGG + Intronic
1067809864 10:49418130-49418152 GCTCCTGGGCCTGGGGGCACTGG - Intergenic
1069024048 10:63521339-63521361 GGGCGGGGGCGGGCGGGGACGGG + Intergenic
1069469369 10:68673594-68673616 GCTCGTGGGTGGGTAGGCAGTGG + Intronic
1070752751 10:78973767-78973789 GCGGGAGGGCGGGCGGGCAGGGG + Intergenic
1072336551 10:94403067-94403089 GCTCGCGGGCTGGCGCGCGCCGG + Exonic
1074146297 10:110720308-110720330 GCTGGTGGCCGGGTGGACACAGG - Intronic
1074458321 10:113614507-113614529 GCACGTGGGCGGCCCCGCACTGG + Intronic
1074761426 10:116669962-116669984 GATCCTGGGCGGCCGGGCAGAGG - Exonic
1075944918 10:126424457-126424479 TCGCGTGGGCAGGAGGGCACAGG + Intergenic
1076371752 10:129959818-129959840 GCACGTGGCCGCGCGGGCTCGGG - Intronic
1076413788 10:130270773-130270795 GCTCCTGGCCAGGCTGGCACAGG - Intergenic
1076479930 10:130778262-130778284 TCCCGTGGGCTGGCGGGCCCAGG - Intergenic
1076554295 10:131311824-131311846 GGGCGCGGGCGGGCGGGGACCGG - Intergenic
1077104155 11:834739-834761 GCTGCAGGTCGGGCGGGCACGGG + Intronic
1077144355 11:1037945-1037967 GCTCCCGGGCGTGTGGGCACAGG - Intergenic
1077150468 11:1070824-1070846 TCTGCTGGGCAGGCGGGCACTGG - Intergenic
1078454064 11:11461561-11461583 GCTCGGTGGCGGGCGGGAGCGGG - Intronic
1081863491 11:46347402-46347424 GCTCGGCGGCGGGCAGGCAGCGG + Intronic
1083890575 11:65593736-65593758 GCACGTGGGCGGCTGAGCACAGG + Exonic
1083922324 11:65787526-65787548 GCGGGCGGGCGGGCGGGCGCAGG + Intronic
1084089544 11:66870889-66870911 GCTCCTGCGAGGGCGGGCAGGGG + Exonic
1084652531 11:70497623-70497645 GCTCATGGGCTGGGGGGCTCTGG - Intronic
1087188685 11:95230698-95230720 GCTCGTCCCCGGGCGCGCACTGG - Intronic
1088462306 11:110093737-110093759 GCCCCCGGGCGGGCGGGGACCGG - Intronic
1089145740 11:116328673-116328695 GCTCCTGGGCAGGAGGGCCCTGG + Intergenic
1091777097 12:3191638-3191660 GCTCAAGGGAGGGCAGGCACAGG - Intronic
1096127664 12:49131434-49131456 GCGGAGGGGCGGGCGGGCACAGG + Intergenic
1096720421 12:53517087-53517109 GCTCTTGGGCGGGCGAGCTCTGG + Exonic
1097848592 12:64390282-64390304 GCGGGTGGGCAGGCGGGCTCGGG - Intronic
1099195497 12:79610019-79610041 CCTCGTGGGAGGGGGAGCACAGG - Intronic
1100608316 12:96169962-96169984 GCTCGTGAGCTGGCGGGCAGGGG + Intergenic
1101865267 12:108515606-108515628 GCTCCTGGGCGGGGCGGTACAGG - Intronic
1101870573 12:108562433-108562455 TCTCGGGGGCGGGCGGGGTCGGG - Intergenic
1104082824 12:125445869-125445891 GCTGGTGGGTGGGTGGGCAGGGG - Intronic
1104836283 12:131793906-131793928 GCTCGGGGGAGAGTGGGCACGGG + Intronic
1105750551 13:23419184-23419206 GGTCATGGGCGGACAGGCACGGG + Intronic
1105975500 13:25468882-25468904 GGCCGCGGGCGGGCGGCCACCGG - Intronic
1106308340 13:28532634-28532656 GCGCGGGGTCGGGCGGGGACCGG + Intergenic
1107217196 13:37935100-37935122 GATGGTGGGGGGGCGGGCATGGG + Intergenic
1111939694 13:94596281-94596303 GCTAGTGGGCGGGCAGAAACTGG - Intergenic
1113655242 13:112063698-112063720 GCTGGGGGGCGGGCGGGAGCGGG + Intergenic
1114224261 14:20723650-20723672 GCTCCAGGGCGGGCGCGCTCAGG - Intergenic
1114259152 14:21025114-21025136 GCCCGTGGGCGGGCTGGGGCGGG - Intronic
1121224141 14:92308900-92308922 GCTCGTGGCCAGACGAGCACTGG - Intergenic
1122830749 14:104394481-104394503 GCTCGGGGGCAGGAAGGCACAGG - Intergenic
1124629219 15:31327503-31327525 GCTCGGGGGCGGGCGGCGGCAGG - Exonic
1124999389 15:34754818-34754840 TCTCCTGGGCGGGCGAGCGCTGG - Exonic
1125329073 15:38564742-38564764 GCTCGAGGGCTGGCGGGCGCCGG - Exonic
1127765919 15:62185921-62185943 GCTCGTGGTCTGGCTGGCTCAGG + Intergenic
1128454130 15:67823244-67823266 GCCCGCGGGCGGGCGGACCCGGG + Intronic
1128454884 15:67826888-67826910 GCTAGTGGCCCGGCGGGCCCAGG + Exonic
1131058811 15:89391908-89391930 GCTGGGGGGCGGGCTGGCAGAGG + Intergenic
1131517577 15:93089242-93089264 GCTCGGCGGCGGGCGGGGGCCGG - Intergenic
1132522231 16:397135-397157 GCTCCCGGGCGGGCGGGGGCGGG + Intronic
1132648650 16:1010532-1010554 GCTGGTGGGAGGCCGGGCAGAGG + Intergenic
1132849894 16:2020246-2020268 GCTCTGGGGCGCGCGGGCTCCGG - Exonic
1132943560 16:2520258-2520280 GCGGGCGGGCGGGCGGGCGCCGG + Intronic
1136037220 16:27549626-27549648 GCGGGCGGGCGGGCGGGCGCAGG - Intronic
1137513299 16:49120243-49120265 ACTGGTGGGCGGGCAGGAACTGG + Intergenic
1137617713 16:49856998-49857020 GCTGGCGGGCGGGCCGGCGCCGG - Intronic
1137728636 16:50673738-50673760 GCTCCAGGGCGCGCGGGTACTGG + Exonic
1138379297 16:56589337-56589359 GGGCGTGGGCGAGCGGGCCCCGG + Intronic
1141231341 16:82170352-82170374 GCTCGCGGGGTGGCGGGCGCGGG + Intergenic
1141495796 16:84408517-84408539 GCTCCCGGGCGGGCAGCCACAGG + Intronic
1141785913 16:86200840-86200862 TTTCCTGGGCGGGCGGGCCCTGG - Intergenic
1142154640 16:88527515-88527537 GCGCGTGAGCGGGCCGGCTCAGG + Intronic
1142293222 16:89202002-89202024 GCCCGGGGGCGCGCGGGCTCCGG + Intergenic
1143247798 17:5500779-5500801 GCGCGCGGGCGGGAGGGCGCAGG - Intronic
1143681916 17:8482028-8482050 TCCCGTGGGCTGGCAGGCACAGG - Intronic
1146577787 17:34010116-34010138 GCTCCTGGGCTGGTGGGCAGGGG + Intronic
1147000617 17:37359400-37359422 GCTAGAGGGCGGGCGGGCCGCGG + Intronic
1147312527 17:39604036-39604058 GCTGGTGGGTGGGCGGGGAGAGG - Intronic
1149725868 17:58893693-58893715 GCTGGTGGGTGTGTGGGCACAGG + Intronic
1150577606 17:66443974-66443996 GCTCGTGAGGCGGAGGGCACAGG - Intronic
1151334478 17:73431918-73431940 GCACGTGGTGTGGCGGGCACAGG - Intronic
1151727375 17:75892724-75892746 CATGGTGGGCGGGCAGGCACAGG + Intronic
1152564714 17:81095172-81095194 GCTCAGCGGCGGGCGGGGACTGG + Intronic
1152600423 17:81259485-81259507 GCTCGTGGGAGGGCTGGCCTGGG + Intronic
1152930632 17:83107841-83107863 GCTCGGGGGCGGGGGGAGACGGG + Intergenic
1154251707 18:12750303-12750325 GCTCGAGGGAGGGCAGCCACAGG + Intergenic
1157422904 18:47560899-47560921 TCTGGGGGGCTGGCGGGCACTGG - Intergenic
1157480442 18:48050381-48050403 GCTCGTGGCGGGCAGGGCACAGG - Intronic
1161101471 19:2424051-2424073 GCGCGTGGGCAGGCGGACCCAGG - Intronic
1161321434 19:3643480-3643502 TCTGGGAGGCGGGCGGGCACTGG - Intronic
1161471272 19:4457725-4457747 CCGCGGGGGCGGGGGGGCACGGG + Exonic
1161494926 19:4581500-4581522 GCGCGAGGGCGGGAGGGCGCGGG + Intergenic
1161924940 19:7293529-7293551 GCCCGCGGCGGGGCGGGCACCGG + Intronic
1161961627 19:7526609-7526631 GCTGGTGGGCGGGCAGGTGCTGG + Intronic
1161961649 19:7526681-7526703 GCTGGTGGGCGGGCAGGTGCAGG + Intronic
1162095580 19:8307988-8308010 GCTTGTGGGAAGGCGCGCACTGG - Intronic
1162124097 19:8490131-8490153 GCTCCTGGGTGAGCGGGCGCTGG + Exonic
1163666706 19:18606903-18606925 GCCCGCGGGCGGGCGGGCGGCGG - Intronic
1163849172 19:19653867-19653889 GGTGGTAGTCGGGCGGGCACTGG + Exonic
1164926104 19:32131277-32131299 TCTCGTGGGCTGACGGCCACAGG + Intergenic
1164990054 19:32676455-32676477 GCTCGTCGGCGGCCAGGCCCCGG - Exonic
1165449612 19:35874482-35874504 GCTGGGGAGCGGGTGGGCACAGG - Exonic
1165795674 19:38517688-38517710 GCTGGTGGGTCGGGGGGCACTGG + Exonic
1166347768 19:42177014-42177036 GCGGGCGGGCGGGCGGGCAGGGG + Intronic
1166984221 19:46649825-46649847 GGTGGTGGGCGCGCGGGCAGCGG - Exonic
1167674610 19:50876679-50876701 GCTCCTGGGTGGGCAGGCCCAGG - Exonic
1168702812 19:58451768-58451790 GCCCGGGGGCGGTCGGGCCCCGG + Intronic
924987893 2:288126-288148 GCTGGCGGGCGGGCGGGTTCCGG - Exonic
926077383 2:9951942-9951964 CCGCGCGGGCGGGCGGGCGCGGG + Intronic
926319953 2:11742833-11742855 GCTGGTGGGCGGGGGAGCTCGGG - Intronic
928540347 2:32278314-32278336 GGTCGTGGCCGGGTGGGGACAGG + Intronic
934655947 2:96116858-96116880 GCTAGCGCGCGGGCCGGCACCGG + Intergenic
937145296 2:119639076-119639098 GGGGGTGGGGGGGCGGGCACCGG + Intronic
939617488 2:144377551-144377573 ACTCATGGGTGGGCGGGCAGTGG + Intergenic
939980806 2:148778530-148778552 GGTGGTGGGCGGGGGGGCAGGGG - Intronic
944111434 2:196135488-196135510 GCTCCTGGGCGGGGGCGCAGTGG + Exonic
947514003 2:230785371-230785393 GCGCGTGGGCAGGGGGGCAGGGG + Intronic
948463817 2:238142840-238142862 GGTGGTGGGCGGGCAGGCGCTGG + Exonic
948604586 2:239126788-239126810 ACGCCTGGGCTGGCGGGCACAGG - Intronic
948625173 2:239264117-239264139 GCTCGTGGGGAGACGGGCTCTGG + Intronic
948645181 2:239400329-239400351 GGGCGGGGGCGGGCGGGCGCCGG - Intronic
948767048 2:240227863-240227885 GCTCCTGGGAGGGCGGGGACAGG - Intergenic
948807935 2:240460978-240461000 GCTGGTGGGGGGGCGGACACAGG - Intronic
948893092 2:240916468-240916490 GCGCGGGGGCGCGGGGGCACGGG - Intergenic
1172271701 20:33658858-33658880 GCTGGTGCGGGGCCGGGCACAGG + Intronic
1173165955 20:40687696-40687718 GCGGGTGCGCGGGCGGGCAGGGG - Exonic
1175911502 20:62407312-62407334 GCGCGCGGGCGCGCGGGCAGGGG - Intergenic
1176110053 20:63407015-63407037 GCTCGTGGGCAGGCGGCGGCGGG + Exonic
1176207171 20:63895373-63895395 GCAGGCGGGCGGGCGGGCGCGGG + Intronic
1180259927 21:46662055-46662077 GCACGTGGGGGCGCGGGCAGTGG + Intronic
1180609265 22:17085154-17085176 GCTCCTGGGCGTGCTGGCCCCGG + Exonic
1183019795 22:35018112-35018134 GCTAGTGGGAGGCTGGGCACTGG - Intergenic
1183352967 22:37344014-37344036 GGGCGTGGGCAGGCGGGCATAGG - Intergenic
1183427090 22:37745983-37746005 GCCGGAGGGCGGGCGGGCCCGGG - Intronic
1183495721 22:38142748-38142770 GCTCGTGGGCCAGCGGGACCTGG - Intronic
1185339174 22:50284020-50284042 GGTCGGGGGCGGGCAGGCACGGG - Intronic
949559480 3:5188332-5188354 GCGCGTGGGCGCGCGGCCCCGGG - Intronic
952351593 3:32543980-32544002 GCTGGTGGGGGGGCGGGCAGAGG + Intronic
954076910 3:48188189-48188211 GCCAGCGGGCGGGCGGGCGCCGG + Exonic
954297674 3:49683173-49683195 GCTGGTGGGCAGGTGAGCACAGG + Intronic
954797845 3:53170513-53170535 GCAGGTGGGCGGGCGGGCGGAGG + Intronic
960338325 3:116445418-116445440 GCTGGCGGGCGGGCGGGCGAGGG + Exonic
960639144 3:119810206-119810228 GCGCGCGGGCGGGCCGGCGCCGG + Intronic
961336105 3:126180582-126180604 GCTCGCGGACTGGCGGGGACAGG - Intronic
961688212 3:128650314-128650336 GCAGGAGGGCGGGCGCGCACCGG + Intronic
968230432 3:197002423-197002445 CCTCGCGGAGGGGCGGGCACGGG + Exonic
969330323 4:6470946-6470968 GCGCGGGCGCGGGCGGGCTCGGG - Intronic
969424587 4:7116694-7116716 GCTCGTGGGCTAGGGGGCATTGG + Intergenic
972533055 4:39977575-39977597 GCTCCCGGGCGGGCGGGCGGCGG - Exonic
975420521 4:74158371-74158393 GCTCGTGGGCGGCCGCGCGGCGG + Intronic
976068415 4:81215333-81215355 GCTAGTGTGCGTGCGGGCGCGGG - Intergenic
979713351 4:123807241-123807263 GGTCATGGGGGGGCGGGCAAAGG + Intergenic
981316978 4:143349788-143349810 CCTCGTGCGCTGGCCGGCACGGG + Intronic
988350973 5:30106742-30106764 CCTCGTGGGAGGGGGAGCACAGG - Intergenic
989209520 5:38845802-38845824 CTTTGCGGGCGGGCGGGCACTGG - Intergenic
991024333 5:62013992-62014014 TCACGTGGGCTGGCGAGCACTGG - Intergenic
996387443 5:122924448-122924470 GCTCGTGTGCTGGCTGGGACCGG + Intronic
999445077 5:151632753-151632775 GCGTGTGGAAGGGCGGGCACCGG + Intergenic
999454349 5:151702597-151702619 GCTCATGGGAGGGCAGCCACGGG + Intergenic
999900591 5:156082261-156082283 GCTGGTGGGCGGGGGGGTCCAGG + Intronic
1000071407 5:157743963-157743985 GCGCGGGCGCGGGCGGGCTCGGG + Exonic
1000279950 5:159773630-159773652 GCGCGGGGTCGGGCGGGAACCGG + Intergenic
1002524267 5:179806717-179806739 GCCCGGGGCCGGGCGGGGACCGG + Intronic
1003427541 6:6007637-6007659 CCTTGTGTGCGGGCGGGCATGGG - Intergenic
1003578006 6:7315222-7315244 AGGCGTGGGCGGGCGGGAACTGG + Intronic
1005248179 6:23912955-23912977 GCTGGGGGGAGGGCGGGGACGGG - Intergenic
1006606250 6:35259735-35259757 GCGCGCGGGCGGGCGGGCTATGG + Exonic
1007628102 6:43257894-43257916 GCTCGTGGACAGGAGGGCATCGG - Exonic
1007764268 6:44151781-44151803 GGCAGTGGGCGGGCGGCCACCGG + Intronic
1018579985 6:165300587-165300609 GCGAGTGGGCGGGGCGGCACAGG + Intronic
1019174436 6:170153035-170153057 CCTGGCGGGCGGGCGAGCACAGG - Intergenic
1019474519 7:1237517-1237539 GCGCCGGGGCGGGCGGGGACCGG - Intergenic
1021719247 7:23490434-23490456 GGGCGGGGGCGGGCGGGCGCGGG + Intergenic
1022375535 7:29807503-29807525 CCCCGTGGGCAGGCAGGCACCGG + Intronic
1027138013 7:75638625-75638647 GCCCGTGGGCAGGGAGGCACAGG - Intronic
1032710853 7:134458968-134458990 GCTCGTGGGGGCGCGGGCCCGGG - Intronic
1033361288 7:140640583-140640605 GCTCGGGGGCGGGCGGCGGCGGG + Exonic
1034147324 7:148884443-148884465 GCTCGTGGGCGGGCGGGCACTGG + Intergenic
1035125832 7:156607419-156607441 GCTCGGGCGCGGGTGGGCGCGGG - Intergenic
1035351208 7:158247495-158247517 GCTCGTGGGCAGCTGGGCACTGG + Intronic
1035702146 8:1644260-1644282 GCTCTTGGTCGGGCGGGCTTAGG - Intronic
1036578821 8:10054386-10054408 GGGCGCGGGCGGGCGGGCGCGGG - Exonic
1037811468 8:22089381-22089403 GCAGGAGGGCGGGCGGGCGCGGG + Intronic
1039469020 8:37802295-37802317 GCTGGTGGAGGGGCGGGCCCAGG + Intronic
1041176904 8:55206403-55206425 GCTCCTGGGTGGGTGGGGACTGG - Intronic
1042561157 8:70072558-70072580 CGTCGGGGGCGGGCGGGCGCGGG - Intergenic
1049672138 8:143874689-143874711 GCTCCTGGGTGGGTGGGCACAGG - Intronic
1050744633 9:8860864-8860886 GCTGGTGGGATGGAGGGCACTGG - Intronic
1051304922 9:15699271-15699293 GCTCGTGGGCTCGCTGGCTCAGG + Intronic
1053001147 9:34577936-34577958 GCTGGCGGGCGGGCGAGCGCGGG + Intronic
1056992282 9:91423561-91423583 GCGGGCGGGCGGGCGGGCGCGGG - Intronic
1057605753 9:96496793-96496815 GCTCTCGGGCCGGCGGGCAGAGG - Intronic
1186575009 X:10755925-10755947 GCATGTGGGCGGGCAAGCACAGG - Intronic
1188182467 X:27072940-27072962 CCTCGTGGGAGGGTGAGCACAGG - Intergenic
1189298837 X:39937680-39937702 GGTGGTGGGGGGGCGGGCCCTGG - Intergenic
1200101118 X:153689407-153689429 GCGGGCGGGCGGGCGGGCATGGG - Intronic