ID: 1034147324

View in Genome Browser
Species Human (GRCh38)
Location 7:148884443-148884465
Sequence GCTCGTGGGCGGGCGGGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 194}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034147311_1034147324 8 Left 1034147311 7:148884412-148884434 CCGAGCCAGCCCCACGCAGAGTG 0: 1
1: 0
2: 0
3: 21
4: 234
Right 1034147324 7:148884443-148884465 GCTCGTGGGCGGGCGGGCACTGG 0: 1
1: 0
2: 0
3: 10
4: 194
1034147312_1034147324 3 Left 1034147312 7:148884417-148884439 CCAGCCCCACGCAGAGTGCGCTC 0: 1
1: 0
2: 0
3: 5
4: 103
Right 1034147324 7:148884443-148884465 GCTCGTGGGCGGGCGGGCACTGG 0: 1
1: 0
2: 0
3: 10
4: 194
1034147308_1034147324 27 Left 1034147308 7:148884393-148884415 CCCGCCGGGCTCGGAGGCGCCGA 0: 1
1: 0
2: 0
3: 13
4: 109
Right 1034147324 7:148884443-148884465 GCTCGTGGGCGGGCGGGCACTGG 0: 1
1: 0
2: 0
3: 10
4: 194
1034147310_1034147324 23 Left 1034147310 7:148884397-148884419 CCGGGCTCGGAGGCGCCGAGCCA 0: 1
1: 0
2: 0
3: 10
4: 112
Right 1034147324 7:148884443-148884465 GCTCGTGGGCGGGCGGGCACTGG 0: 1
1: 0
2: 0
3: 10
4: 194
1034147317_1034147324 -3 Left 1034147317 7:148884423-148884445 CCACGCAGAGTGCGCTCAGGGCT 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1034147324 7:148884443-148884465 GCTCGTGGGCGGGCGGGCACTGG 0: 1
1: 0
2: 0
3: 10
4: 194
1034147309_1034147324 26 Left 1034147309 7:148884394-148884416 CCGCCGGGCTCGGAGGCGCCGAG 0: 1
1: 0
2: 1
3: 5
4: 93
Right 1034147324 7:148884443-148884465 GCTCGTGGGCGGGCGGGCACTGG 0: 1
1: 0
2: 0
3: 10
4: 194
1034147314_1034147324 -1 Left 1034147314 7:148884421-148884443 CCCCACGCAGAGTGCGCTCAGGG 0: 1
1: 0
2: 2
3: 5
4: 151
Right 1034147324 7:148884443-148884465 GCTCGTGGGCGGGCGGGCACTGG 0: 1
1: 0
2: 0
3: 10
4: 194
1034147316_1034147324 -2 Left 1034147316 7:148884422-148884444 CCCACGCAGAGTGCGCTCAGGGC 0: 1
1: 0
2: 0
3: 2
4: 76
Right 1034147324 7:148884443-148884465 GCTCGTGGGCGGGCGGGCACTGG 0: 1
1: 0
2: 0
3: 10
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034147324 Original CRISPR GCTCGTGGGCGGGCGGGCAC TGG Intergenic