ID: 1034151626

View in Genome Browser
Species Human (GRCh38)
Location 7:148921473-148921495
Sequence TTGTTTTAACAGCAGCCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 226}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034151626 Original CRISPR TTGTTTTAACAGCAGCCAGT AGG Intergenic
900743657 1:4345555-4345577 TTGTTTTAAGATCACCCAGTTGG - Intergenic
902089421 1:13891774-13891796 TTTTTTTAACAGCAGCTAATGGG + Intergenic
902129193 1:14244094-14244116 TTGTTTTAACAGAAGCCACATGG - Intergenic
906816510 1:48885783-48885805 TGGTATAACCAGCAGCCAGTGGG - Intronic
907580962 1:55572371-55572393 TTTTTGTCACAGCAGCCACTGGG - Intergenic
907842940 1:58174146-58174168 TTGTTTTTACACTAACCAGTTGG + Intronic
907999656 1:59668121-59668143 TTGTGATATCAGCAGACAGTGGG + Intronic
910235651 1:85033475-85033497 TACTTTTAACAACAGCCACTAGG - Intronic
910664146 1:89706332-89706354 TTGTTTTAACCTCAGCCCTTTGG + Intronic
911502054 1:98699339-98699361 TTCTTTTAAAAGCAACCAGAAGG - Intronic
912881559 1:113421704-113421726 TTGTTTTATCTACAGCCAGTAGG + Intronic
913722010 1:121605944-121605966 TTCTTTTAACGGCAGTCATTTGG - Intergenic
913741794 1:121853526-121853548 TTCTTTTAACGGCAGTCATTTGG - Intergenic
915261065 1:154677395-154677417 TTGTTTTTACACTAACCAGTAGG + Intergenic
915832467 1:159143797-159143819 TTGTATTCCCAGCAGCAAGTGGG - Intronic
916684215 1:167130063-167130085 TTGCTTTAACAGCAGCTATGTGG - Intergenic
917445563 1:175103302-175103324 TTGTTTTTACACTAACCAGTCGG - Intronic
918557121 1:185816290-185816312 TTGTTTGAAAAGCAGTCACTGGG + Intronic
918604585 1:186407175-186407197 TTATTTTAACATCAGGCATTGGG - Intronic
919788819 1:201277029-201277051 TAGTGCTGACAGCAGCCAGTCGG + Intergenic
920366850 1:205452455-205452477 CTGTTCCAACAGGAGCCAGTGGG + Intronic
920654105 1:207862479-207862501 TTTTTTTGAAAACAGCCAGTTGG - Intergenic
922862390 1:228830444-228830466 GTGATTTCACAGCAGCCAGATGG - Intergenic
922919767 1:229292814-229292836 TTTTCTTCACACCAGCCAGTCGG + Intronic
923381821 1:233428000-233428022 TAGTTTTAACATCTGTCAGTAGG + Intergenic
924476059 1:244382900-244382922 GTGTCTTCACAGCAGCCAGAGGG - Intronic
1063321195 10:5054101-5054123 TTGTTTTCACACTAACCAGTCGG - Intronic
1063836904 10:10025287-10025309 TTCTCTTAAGAGCAGCCTGTTGG + Intergenic
1065170726 10:23024828-23024850 TTATTTAAACAGCATACAGTCGG - Intronic
1065640776 10:27780076-27780098 TTGCTTTCACAGAGGCCAGTAGG + Intergenic
1068782709 10:60938928-60938950 TTGTTATCACAGCAGTCATTAGG + Intronic
1068939845 10:62670106-62670128 TGGGTTTCACAGCAGCCAGCTGG + Intronic
1069273615 10:66562362-66562384 GTGTGTGAACATCAGCCAGTTGG - Intronic
1070273181 10:74978157-74978179 TATTTTTAGTAGCAGCCAGTTGG + Intronic
1074461743 10:113644520-113644542 TTATTTAAAAAGCAGGCAGTGGG + Intronic
1075303503 10:121346738-121346760 TTTTTTTAAAGGCAGCCAGAAGG - Intergenic
1078526176 11:12103310-12103332 TTGCTTAAACAGCACCCAGCAGG - Intronic
1078882231 11:15463643-15463665 AGGTCTTCACAGCAGCCAGTTGG + Intergenic
1079411269 11:20190104-20190126 TTGCTTTGAGAGCAGCCAGAGGG - Intergenic
1079807145 11:24946948-24946970 TTATTTTTAAAGCAGCCAGCAGG + Intronic
1080939936 11:36904747-36904769 TTGTTTTTAAATCAGCCAGAGGG - Intergenic
1081122307 11:39282862-39282884 TAGCTTTAACAGCAGCATGTTGG - Intergenic
1081923697 11:46804117-46804139 TTGTTGGAACAGTAACCAGTGGG + Intronic
1082864784 11:57888641-57888663 CTGTTTTAACAGGAGCCAGATGG - Intergenic
1085802098 11:79600210-79600232 TTTTTTTTACAGCAGCCTGAAGG + Intergenic
1090042138 11:123300503-123300525 GTTTATTAACAGCACCCAGTGGG - Intergenic
1092527053 12:9315733-9315755 TTGTTACAGCACCAGCCAGTTGG + Intergenic
1093346115 12:18039617-18039639 TTGTTTTTACACTAACCAGTAGG + Intergenic
1093915779 12:24801191-24801213 TTCTTTTTACAGCAGTCAATCGG + Intergenic
1095942674 12:47737070-47737092 TTCTTCCAACAGCAGGCAGTGGG - Exonic
1098157683 12:67617096-67617118 ATGTTTTGACACCAGCCAGAAGG - Intergenic
1098221420 12:68273956-68273978 TTGCTTGAACAGCAGACAGATGG + Intronic
1098331820 12:69360868-69360890 TGTTTTTATCAGGAGCCAGTGGG + Intronic
1099931245 12:89077514-89077536 TTATTTTAAAAGCAGGCAGCAGG + Intergenic
1100881583 12:99024424-99024446 TTGTTTGCACAGCAGGAAGTTGG - Intronic
1104533396 12:129594387-129594409 TTGTTTTCATAGCTGCCAGGAGG + Intronic
1105418094 13:20230878-20230900 TTGTTTAAAAAACAACCAGTGGG + Intronic
1105632887 13:22188714-22188736 TTTTTTTATCAGTAGCAAGTAGG - Intergenic
1106640091 13:31574878-31574900 TAGTTGTAATATCAGCCAGTTGG - Intergenic
1106643589 13:31609829-31609851 TTGTTTTTACACTAACCAGTAGG - Intergenic
1108017521 13:46091643-46091665 TTGTTTAAAAAGCAGACACTTGG + Intronic
1110273189 13:73614248-73614270 TTGTTTTAACAACATCCTATTGG - Intergenic
1110301516 13:73934628-73934650 TAGTCTTAAAAGCAGCCAGGGGG - Intronic
1111139701 13:84099925-84099947 TTGTCTTTGCAGCATCCAGTTGG - Intergenic
1112206517 13:97328891-97328913 TTGTTTTAAAATAAGCCATTAGG + Intronic
1112293473 13:98165509-98165531 TTGTTTTAACAGAAGGCCGTGGG + Intronic
1112519659 13:100084358-100084380 TTGTTTTTACACTAACCAGTCGG + Intergenic
1114810179 14:25889881-25889903 TTGTTTTAAGATTAGTCAGTGGG - Intergenic
1115009579 14:28529120-28529142 TTATTTTAACAGCAGCTGGCTGG + Intergenic
1115715532 14:36099014-36099036 TTCTTTTCACAGTAGTCAGTAGG + Intergenic
1115717825 14:36125267-36125289 TTGTTTAACCTGCAGCCTGTGGG + Intergenic
1117023190 14:51593512-51593534 GTGTTGTACCAGCAGACAGTTGG + Intronic
1118448393 14:65873246-65873268 TTGTTTTAACAAACGCAAGTTGG - Intergenic
1120114926 14:80604106-80604128 TTATTATAACAGCATCCTGTTGG + Intronic
1120695539 14:87640310-87640332 TTTTTTTAACAACAAGCAGTGGG + Intergenic
1121348095 14:93150913-93150935 TTGCTTAAACTGCATCCAGTGGG + Intergenic
1121927709 14:97944063-97944085 GTGTTTCACCAGAAGCCAGTTGG - Intronic
1124580269 15:30947250-30947272 TTGTTCTAACAGCTGCCAGGTGG + Exonic
1127034284 15:54897686-54897708 ATGTTTTAACAGCTGCTATTTGG - Intergenic
1127561691 15:60144758-60144780 TTGTTTTAGCAGCATGCAGTTGG + Intergenic
1127689433 15:61380356-61380378 TTGTGGAAACAGCAGCCATTGGG - Intergenic
1130953295 15:88609316-88609338 TTGTCTTAATACTAGCCAGTAGG - Intergenic
1132115561 15:99133073-99133095 TTGTTTTAATGGCAGCCTGTTGG + Exonic
1133569826 16:7030358-7030380 TTGTTTTAAAGCCATCCAGTTGG - Intronic
1135660440 16:24291977-24291999 TTGTTTTAGGATGAGCCAGTGGG + Intronic
1136378267 16:29877935-29877957 TTGCGTTAACACCAGCAAGTTGG - Intronic
1138164382 16:54786693-54786715 TTGTTTAACCCGCAGCCTGTGGG - Intergenic
1140764028 16:78139342-78139364 TTGTATAAAAAGCAGACAGTAGG + Intronic
1141021468 16:80500717-80500739 CTGTTTTAACATCAACCAGGAGG + Intergenic
1143264258 17:5624029-5624051 TTTTGTCAATAGCAGCCAGTGGG + Intergenic
1143533742 17:7523196-7523218 TTGTTCTAACAGCAGTTAGATGG - Intergenic
1149071952 17:52554083-52554105 TTGCTTTCAGAGCAGCCAGGAGG + Intergenic
1149251130 17:54770749-54770771 TTGCCTTAACAGCTGCAAGTGGG - Intergenic
1154048018 18:10925990-10926012 TTTCTCTAACAGCAGCCAGTTGG - Intronic
1154344377 18:13530181-13530203 TGGTTTTTACAGCAGCAGGTCGG - Intronic
1156366130 18:36428966-36428988 ATGTTTTAGCAGCAGTCAGTCGG + Intronic
1156939808 18:42753493-42753515 GCATTTTAACAGCACCCAGTAGG - Intronic
1160373000 18:78390172-78390194 TTATTGTACCAGCAGACAGTAGG + Intergenic
1161650408 19:5480729-5480751 TTCTCTGAACAGCAGCCAGAGGG - Intergenic
1162443353 19:10707138-10707160 CTGTTTATACAGCAGCCAGAAGG - Intronic
1162463577 19:10827964-10827986 GTGTTTGAACAGAAGCCAGGTGG + Intronic
1163556645 19:17997129-17997151 TTACTGTTACAGCAGCCAGTGGG - Intronic
1167924282 19:52810633-52810655 TGGTTTTAACAGCAGGCTCTGGG + Intronic
1202639820 1_KI270706v1_random:71365-71387 TTGTTTAAACAGCTGACATTTGG + Intergenic
925692077 2:6535664-6535686 TTGTTTCAGCAGCTGCCTGTGGG - Intergenic
925696734 2:6588063-6588085 TGGTTTTCACAGCAGCCCTTAGG - Intergenic
926870552 2:17410895-17410917 TGGTATTGACAGAAGCCAGTTGG + Intergenic
927320819 2:21743747-21743769 TTGTTTTTATAGCAGCCAGTAGG + Intergenic
927530965 2:23800171-23800193 TTGTTTTACCAGCACAGAGTGGG - Intronic
928209325 2:29311995-29312017 ATGCTTTAACAGCAGCCAAGGGG - Intronic
930578377 2:53180431-53180453 TTCTGTACACAGCAGCCAGTGGG - Intergenic
931958788 2:67458687-67458709 TTGTTTTACCAGGTTCCAGTTGG + Intergenic
933996681 2:87675296-87675318 TTGTTTTAAGAACAGCTTGTAGG - Intergenic
934674574 2:96240603-96240625 TTGTTTTCCCAGCGGGCAGTTGG + Intergenic
935098332 2:99968477-99968499 TTGCTTTAATTGCAGCCACTTGG - Intronic
935198451 2:100835133-100835155 TTGCTTTGACAGCAGTCACTTGG + Intronic
935467327 2:103414462-103414484 TTGAATTAACAGCAGCTATTTGG + Intergenic
936297172 2:111275614-111275636 TTGTTTTAAGAACAGCTTGTAGG + Intergenic
936754646 2:115692657-115692679 CTGTTTTAACAACAGCTGGTTGG + Intronic
939282033 2:140076150-140076172 TTGTGTGGGCAGCAGCCAGTGGG + Intergenic
940358817 2:152775196-152775218 TTGTTTTAATAGCAAACAGCAGG + Intergenic
942100701 2:172580202-172580224 TTGTTTTTACAGCAAACAGATGG - Intronic
944194171 2:197035159-197035181 TTGTTAACTCAGCAGCCAGTTGG - Intronic
944729481 2:202502747-202502769 TTGTTTTTACACTAACCAGTCGG + Intronic
945338370 2:208619357-208619379 TTGTCTTTCCAGCTGCCAGTGGG - Intronic
947928973 2:233947250-233947272 TTGATTTTACTGCAGCAAGTAGG + Intronic
948086495 2:235254445-235254467 TTTTTATAACAGCAGCCTGGAGG + Intergenic
1169038425 20:2472280-2472302 TTGTTCTCACGGCAGCCAGAGGG + Intronic
1170474188 20:16698635-16698657 TGGTTTTTAAAGCAGCCATTAGG + Intergenic
1171886485 20:30655719-30655741 TTGTTTAAACAGCTGACATTTGG + Intergenic
1173553498 20:43949374-43949396 TTCTTCTCGCAGCAGCCAGTGGG + Intronic
1174217984 20:48931928-48931950 TTTTCTCAACAGCAGCCAGAGGG - Intronic
1176389333 21:6155538-6155560 TTGTTTTTACATGAGCTAGTGGG - Intergenic
1176648150 21:9368965-9368987 TTGTTTAAACAGCTGACATTTGG + Intergenic
1179734137 21:43382700-43382722 TTGTTTTTACATGAGCTAGTGGG + Intergenic
949803809 3:7932895-7932917 TGTTTTTAACAGCAGACTGTTGG - Intergenic
950805482 3:15599495-15599517 TTTTTTTAACAGTAGGCAATGGG - Intronic
952453542 3:33452817-33452839 TTGTTTTTACACTAACCAGTCGG + Intergenic
953937100 3:47055004-47055026 TTTATTTAAGAGGAGCCAGTGGG - Intronic
955186265 3:56718292-56718314 TTGTTTTTACACTAACCAGTCGG + Intergenic
955517836 3:59745679-59745701 TTGTTTTAAAAGAAGCCAGAAGG - Intergenic
955706509 3:61732893-61732915 TTGTTTTCGCAGCAGTTAGTTGG + Intronic
959696588 3:109254966-109254988 TTGTTTAATCAGCAGTCAGGAGG - Intergenic
960313562 3:116147730-116147752 TGATTTTATCAGCAGGCAGTGGG + Intronic
960691752 3:120353232-120353254 TTGTTTTTTCTGCAGTCAGTAGG - Intergenic
960856837 3:122110287-122110309 TTTTTATAACAGAAGTCAGTGGG - Intronic
961054065 3:123772191-123772213 TTGTATTAAAAGTAACCAGTAGG + Intronic
962120632 3:132556672-132556694 ATGTTGGAACAGCAGCCAGAAGG + Intergenic
963775062 3:149430417-149430439 ATGTTTAAACAGAAGCCAGATGG - Intergenic
963853735 3:150233151-150233173 TTGTTTCAACTGCAGTCACTGGG + Intergenic
965460446 3:168955459-168955481 TTGATTTAACATCTGCCAGGGGG - Intergenic
966441383 3:179948704-179948726 TTGTTTTTTCAGCAGCTGGTGGG - Intronic
967852767 3:194094484-194094506 TTGTTTTAAATGTGGCCAGTAGG - Intergenic
1202738736 3_GL000221v1_random:36022-36044 TTGTTTAAACAGCTGACATTTGG - Intergenic
968973256 4:3807436-3807458 TTGTTTAAAAAGAAACCAGTGGG - Intergenic
969988302 4:11234705-11234727 TTGTTATAACACCAGCCACAAGG - Intergenic
971425430 4:26510546-26510568 TGGTAAGAACAGCAGCCAGTTGG - Intergenic
973370062 4:49237718-49237740 TTGTTTAAACAGCTGACATTTGG + Intergenic
973390963 4:49557692-49557714 TTGTTTAAACAGCTGACATTTGG - Intergenic
974881567 4:67764626-67764648 TTATTTTTACTGTAGCCAGTGGG + Intergenic
975600285 4:76092540-76092562 AAGTCTTAAAAGCAGCCAGTGGG - Intronic
977517734 4:98043239-98043261 TTCTTATAACAGCACGCAGTTGG + Intronic
977682543 4:99812027-99812049 TTGTTTCAACACCAGCTACTGGG + Intergenic
977839112 4:101680076-101680098 TGGTTTTATAAGCAGCCAGAAGG - Intronic
980860378 4:138492482-138492504 TTGTTTAAACACAAGCAAGTTGG - Intergenic
984793580 4:183636663-183636685 TTGTTTTTACAGAGGGCAGTAGG - Intergenic
1202767176 4_GL000008v2_random:157220-157242 TTGTTTAAACAGCTGACATTTGG + Intergenic
986636189 5:9824361-9824383 TTGATGGAACAGCAGCCAGATGG + Intergenic
987304794 5:16627337-16627359 ATGTTTTAATAACATCCAGTTGG + Intergenic
988171400 5:27661397-27661419 TTTGTTTGACAGAAGCCAGTTGG - Intergenic
989956333 5:50365119-50365141 TTCTTTTAACAGCAGTCATTTGG + Intergenic
989957788 5:50376192-50376214 TTGTTTTTACACTAACCAGTCGG + Intergenic
990349433 5:54900916-54900938 GTGGATTGACAGCAGCCAGTGGG + Intergenic
992176066 5:74149787-74149809 TTGGTTCACCAGCAGCCATTTGG + Intergenic
993462768 5:88204675-88204697 TTGTCTTAAAAGAAGCCATTAGG + Intronic
994220076 5:97185148-97185170 TCTTTTTAACAGTAGCCATTTGG + Intergenic
994517621 5:100790736-100790758 TTCTTTTTACAGAAACCAGTGGG + Intergenic
1000188277 5:158882305-158882327 TTGGTATAAAAGCAGCAAGTCGG + Intronic
1001937900 5:175718974-175718996 GGGTTCTAACCGCAGCCAGTGGG + Intergenic
1003047696 6:2749237-2749259 GTGTTATAACAGCAACCAGCTGG - Exonic
1005470909 6:26161363-26161385 TGTGTTTAACAGCAGCCAATTGG + Intronic
1007030724 6:38623579-38623601 TTGTTTTTACACTAACCAGTCGG + Intronic
1008095490 6:47335493-47335515 TTCTTTTAACACCAGCAACTGGG - Intergenic
1008680366 6:53865599-53865621 TTGTTTTAACATCAGCGATGTGG + Intronic
1009339722 6:62539053-62539075 TGGTATTAACAGCAGGCACTAGG + Intergenic
1009471267 6:64030535-64030557 TTGTTTTTACACTAACCAGTCGG + Intronic
1010680125 6:78789402-78789424 TTGTTTTAACGTTAGCCATTTGG - Intergenic
1012602401 6:101114418-101114440 TTGTTTTAAAAGGAGTCTGTTGG - Intergenic
1013821222 6:114155470-114155492 TTTTTTTCACAGCAGCCTGGTGG - Intronic
1015085735 6:129289145-129289167 TTATATTAACAGCTGCCAGTTGG - Intronic
1015826266 6:137315519-137315541 CTGTTTTAACATTACCCAGTAGG + Intergenic
1016964434 6:149705734-149705756 TTTTTTTAACAGCAGAAAGAAGG - Intronic
1017503367 6:155045875-155045897 TTGTTTTAGCCATAGCCAGTGGG + Intronic
1019834430 7:3368329-3368351 TCGTTTTAACAGCAGCCTAATGG - Intronic
1020150871 7:5680806-5680828 TTGTTGCATGAGCAGCCAGTGGG - Intronic
1024488663 7:49950329-49950351 TTGTGTTAACAGCATACAGCTGG - Intronic
1025855177 7:65269891-65269913 TTTTTTTAACAGGAGACACTGGG - Intergenic
1026150228 7:67782034-67782056 CTGTTTTAACAACCTCCAGTGGG - Intergenic
1027603234 7:80266206-80266228 ATGGTCAAACAGCAGCCAGTAGG + Intergenic
1030962260 7:115940240-115940262 ATGTTTTAAAAGCAGCAACTTGG - Exonic
1032326196 7:130930848-130930870 ATGTTATAACAGAAGCCACTGGG + Intergenic
1033375088 7:140752350-140752372 CTGGCTTAACAGCAGCCAGCTGG + Intronic
1033789654 7:144776060-144776082 ATGTTTTAAGAGCAGCAAGGAGG - Intronic
1034137482 7:148784246-148784268 CTGTTTGAAAAACAGCCAGTGGG - Intronic
1034151626 7:148921473-148921495 TTGTTTTAACAGCAGCCAGTAGG + Intergenic
1035408307 7:158616259-158616281 TTGCTTCAAAATCAGCCAGTGGG + Intergenic
1035655915 8:1304555-1304577 TTGTTTTAAAAGAAGAAAGTAGG + Intergenic
1035994329 8:4529331-4529353 CTGCTTTAACAGCAGACAGCTGG - Intronic
1036202405 8:6780371-6780393 CTGTTCTCACAGCAGGCAGTAGG - Intergenic
1037504092 8:19513470-19513492 TTTCTTTAACAGCAGGCAGATGG - Intronic
1037843101 8:22259592-22259614 TATTTGTAACAGCAGCCAGATGG + Intergenic
1038639243 8:29310824-29310846 TTGTTTTTACACTAACCAGTCGG + Intergenic
1040882783 8:52225579-52225601 TGGTTTTATCAGCAGCAAGCAGG + Intronic
1040953866 8:52960764-52960786 TTGTTTTTACACTAACCAGTCGG + Intergenic
1043952061 8:86320364-86320386 TTTTTTGAAAAGCAGCCACTTGG - Intronic
1044475145 8:92617240-92617262 CTGTTTTACCAGCAGACATTGGG + Intergenic
1044693555 8:94901251-94901273 ATGTTTTAAAAGCATCCAGCTGG + Intronic
1045188664 8:99862441-99862463 TTGTTTGTAGAGCAGCCAGATGG + Intronic
1047056957 8:121175923-121175945 TTATGTTAACAGCATCTAGTTGG - Intergenic
1047691773 8:127362735-127362757 TGGTTTTAACAGTAGTCATTAGG - Intergenic
1047996168 8:130338611-130338633 TTTTATTAACAGCAGGCAATGGG + Intronic
1050912275 9:11086682-11086704 TTATTTTAACAGAAGACAGAAGG - Intergenic
1051074400 9:13213431-13213453 TTGTTTTGACAGCAGCTATTAGG - Intronic
1052962044 9:34307057-34307079 ATTTTTTTTCAGCAGCCAGTTGG - Intronic
1055566297 9:77571937-77571959 TTCTCTTATGAGCAGCCAGTTGG - Intronic
1057453310 9:95185088-95185110 TAGTTTTATCACCAGCCAATGGG - Intronic
1057474944 9:95391054-95391076 TAGTTTTATCACCAGCCAATGGG + Intergenic
1058825230 9:108769685-108769707 TTGTTGTAACATCACCCACTTGG - Intergenic
1058956815 9:109956700-109956722 TTCTTTTAACAGGAGCGAGCTGG - Intronic
1059211816 9:112519794-112519816 TTGTTTTATCAGAAACAAGTTGG - Intronic
1059741298 9:117152677-117152699 TTGTTTTTCCAGCAGCTAGTTGG + Intronic
1203707466 Un_KI270742v1:66466-66488 TTGTTTAAACAGCTGACATTTGG - Intergenic
1203547928 Un_KI270743v1:142097-142119 TTGTTTAAACAGCTGACATTTGG + Intergenic
1185848351 X:3461792-3461814 TCGTTTTCAAAGCGGCCAGTGGG + Intergenic
1188458034 X:30389555-30389577 ATGTTTTAACAGCATCAACTTGG + Intergenic
1189192888 X:39126118-39126140 TTTTTTTAACAGAAGGAAGTGGG - Intergenic
1194757402 X:97753336-97753358 TTCTTTTAACATGACCCAGTAGG - Intergenic
1196264620 X:113627597-113627619 TTATTTTAAAAGCAGTCAGAGGG - Intergenic
1197000448 X:121432527-121432549 TTGTTTTTACACTAACCAGTAGG - Intergenic
1199342475 X:146697727-146697749 TTGTCTAAACCGCAGCCTGTGGG - Intergenic
1199588620 X:149443099-149443121 TTGTTTTAACTGTAACCATTGGG - Intergenic
1201556184 Y:15266659-15266681 TTGTTTTCACACTAACCAGTTGG + Intergenic
1202297233 Y:23372355-23372377 TTGGTTTAATAGAAGACAGTGGG - Intergenic
1202573574 Y:26298242-26298264 TTGGTTTAATAGAAGACAGTGGG + Intergenic