ID: 1034152571

View in Genome Browser
Species Human (GRCh38)
Location 7:148928530-148928552
Sequence TCCCCCTGCCCAAATTCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034152569_1034152571 -10 Left 1034152569 7:148928517-148928539 CCAACCTAGGTGATCCCCCTGCC No data
Right 1034152571 7:148928530-148928552 TCCCCCTGCCCAAATTCCCAAGG No data
1034152564_1034152571 23 Left 1034152564 7:148928484-148928506 CCAACAGGGTAGGCACCAGCAGC No data
Right 1034152571 7:148928530-148928552 TCCCCCTGCCCAAATTCCCAAGG No data
1034152568_1034152571 -4 Left 1034152568 7:148928511-148928533 CCTAGTCCAACCTAGGTGATCCC No data
Right 1034152571 7:148928530-148928552 TCCCCCTGCCCAAATTCCCAAGG No data
1034152565_1034152571 8 Left 1034152565 7:148928499-148928521 CCAGCAGCCAAGCCTAGTCCAAC No data
Right 1034152571 7:148928530-148928552 TCCCCCTGCCCAAATTCCCAAGG No data
1034152567_1034152571 1 Left 1034152567 7:148928506-148928528 CCAAGCCTAGTCCAACCTAGGTG No data
Right 1034152571 7:148928530-148928552 TCCCCCTGCCCAAATTCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034152571 Original CRISPR TCCCCCTGCCCAAATTCCCA AGG Intergenic
No off target data available for this crispr