ID: 1034159593

View in Genome Browser
Species Human (GRCh38)
Location 7:148983234-148983256
Sequence CCCCCTCCACGGGGAACCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034159583_1034159593 10 Left 1034159583 7:148983201-148983223 CCGGGCTGCAGGGCTCCTCGCAG No data
Right 1034159593 7:148983234-148983256 CCCCCTCCACGGGGAACCGGGGG No data
1034159585_1034159593 -5 Left 1034159585 7:148983216-148983238 CCTCGCAGGACACACGCTCCCCC No data
Right 1034159593 7:148983234-148983256 CCCCCTCCACGGGGAACCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034159593 Original CRISPR CCCCCTCCACGGGGAACCGG GGG Intergenic
No off target data available for this crispr