ID: 1034162335

View in Genome Browser
Species Human (GRCh38)
Location 7:149002639-149002661
Sequence GCAGTGACACGTGTGTGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034162335_1034162339 2 Left 1034162335 7:149002639-149002661 CCCCAACACACACGTGTCACTGC No data
Right 1034162339 7:149002664-149002686 CAGGAGCTGCCGTCAGCGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034162335 Original CRISPR GCAGTGACACGTGTGTGTTG GGG (reversed) Intergenic
No off target data available for this crispr