ID: 1034162588

View in Genome Browser
Species Human (GRCh38)
Location 7:149004151-149004173
Sequence GACGGGTCCCTTGTTGTTCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 42}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034162581_1034162588 17 Left 1034162581 7:149004111-149004133 CCATCACAATGGAGTCAAAGGTC 0: 1
1: 0
2: 0
3: 9
4: 121
Right 1034162588 7:149004151-149004173 GACGGGTCCCTTGTTGTTCTTGG 0: 1
1: 0
2: 0
3: 3
4: 42
1034162585_1034162588 -10 Left 1034162585 7:149004138-149004160 CCACCACGACCTTGACGGGTCCC 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1034162588 7:149004151-149004173 GACGGGTCCCTTGTTGTTCTTGG 0: 1
1: 0
2: 0
3: 3
4: 42
1034162584_1034162588 -9 Left 1034162584 7:149004137-149004159 CCCACCACGACCTTGACGGGTCC 0: 1
1: 0
2: 0
3: 0
4: 27
Right 1034162588 7:149004151-149004173 GACGGGTCCCTTGTTGTTCTTGG 0: 1
1: 0
2: 0
3: 3
4: 42
1034162578_1034162588 29 Left 1034162578 7:149004099-149004121 CCTTCTTGGGGTCCATCACAATG 0: 1
1: 0
2: 0
3: 5
4: 111
Right 1034162588 7:149004151-149004173 GACGGGTCCCTTGTTGTTCTTGG 0: 1
1: 0
2: 0
3: 3
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034162588 Original CRISPR GACGGGTCCCTTGTTGTTCT TGG Exonic
905541184 1:38761707-38761729 GACTGGTTCCTTGTTGTACTTGG + Intergenic
912373650 1:109192861-109192883 TACAGGTACCTTGTTGTTCTTGG - Exonic
1064579634 10:16780781-16780803 GCCGGTTCCATTGTTTTTCTGGG - Intronic
1087050457 11:93881695-93881717 TACTGGTCCCCTGTGGTTCTTGG - Intergenic
1096109578 12:49020866-49020888 GACTGGCCCCTAGTTGCTCTAGG - Exonic
1097409513 12:59234285-59234307 GATGGGTCCATAGGTGTTCTTGG - Intergenic
1103987408 12:124777267-124777289 GACATGCCCCGTGTTGTTCTAGG - Intronic
1106668480 13:31878976-31878998 AATGGTTCCCTTGTTTTTCTTGG + Intergenic
1111195764 13:84872555-84872577 TACTGGTTCCTTGTTGTTCACGG - Intergenic
1112484050 13:99803708-99803730 GATGGTTCACTTGTTGATCTGGG + Intronic
1119407352 14:74407113-74407135 GACGGGTCCCCTTGTGCTCTGGG + Exonic
1129587153 15:76879306-76879328 TTGGGGTCCCTTGTGGTTCTAGG + Intronic
1141945157 16:87304644-87304666 TACGGGTCCCTTGTGGGCCTGGG - Intronic
1147374896 17:40017535-40017557 GACGCGTCTCCTGTTTTTCTGGG + Exonic
1154160866 18:11980641-11980663 GACCGGTCGCTTTTTGTTCGCGG - Intergenic
1160937746 19:1605232-1605254 CCCAGGTCCCTTGTTGTTCCCGG - Intronic
926434617 2:12825205-12825227 GATGGGTCCCTTGGGGTTCTGGG - Intergenic
928382589 2:30832498-30832520 GAAGGGTCCCTCCATGTTCTTGG + Intergenic
937987730 2:127646047-127646069 GAGGGGTCCCTTGTTGTGTCGGG - Exonic
947873221 2:233451086-233451108 GACGGGACCAGTGTTGTGCTAGG - Intronic
1174548366 20:51343468-51343490 GACCAGACCCTTCTTGTTCTTGG + Intergenic
1179043071 21:37822188-37822210 GACAGGTCCCTTGTCATGCTAGG + Intronic
951938940 3:28055729-28055751 GACTGGTCCCCTATTGGTCTTGG - Intergenic
955191295 3:56764117-56764139 GAAGGGTTTCTTGTTGTACTGGG - Intronic
968307995 3:197662119-197662141 GACGGGGCACTTGGTGTTCGGGG - Intergenic
969565751 4:7976604-7976626 CACGGGTACTTTGTTGTTCCTGG + Intronic
971525012 4:27605746-27605768 GACTGCCCCCTTGCTGTTCTTGG + Intergenic
978440754 4:108730901-108730923 GAGGGGTTTCTTGTTGTTCCAGG + Intergenic
980134393 4:128845941-128845963 GATGAGTCCCTGGTGGTTCTGGG + Intronic
985660376 5:1154064-1154086 GATGGGACACTTGTTATTCTCGG - Intergenic
1000289313 5:159855333-159855355 GGATGGTCCCTTGTTCTTCTTGG + Intergenic
1002952937 6:1833291-1833313 GATGTGTCCAGTGTTGTTCTGGG - Intronic
1005219242 6:23567263-23567285 GGTGGGTTCCTCGTTGTTCTTGG + Intergenic
1006167560 6:32073929-32073951 GAGGGGTCTCTTCTTGTTGTGGG + Intronic
1006190464 6:32204435-32204457 GCTGGGTCCCTTGTAGTGCTGGG - Intronic
1016869180 6:148799515-148799537 CAGGGGTCCCTTCTTGTTCAGGG + Intronic
1021243254 7:18231177-18231199 GACTGGTTCCTTACTGTTCTGGG - Intronic
1023173775 7:37415934-37415956 CATGGGTCTCTTGTTGTTTTGGG - Intronic
1031806366 7:126312065-126312087 GGTGGTTGCCTTGTTGTTCTGGG + Intergenic
1034162588 7:149004151-149004173 GACGGGTCCCTTGTTGTTCTTGG + Exonic
1045208027 8:100063992-100064014 GATGGGTCCTTTTTTGTCCTAGG + Exonic
1049320460 8:141993529-141993551 GCCCAGTCCCTTGCTGTTCTGGG + Intergenic
1049656961 8:143803277-143803299 GACGGGTCCCCTGTGCCTCTGGG - Intronic
1055524332 9:77115284-77115306 GTGGGGTCCCTTTTTTTTCTTGG - Intergenic
1187363355 X:18647750-18647772 GTCAGGTCTCTTGTTGTCCTTGG + Intronic
1201338231 Y:12903639-12903661 CATAGGTCCCTTGTTTTTCTGGG - Intergenic