ID: 1034163237

View in Genome Browser
Species Human (GRCh38)
Location 7:149007416-149007438
Sequence GCTTCCCACCAGGAGCTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 233}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034163226_1034163237 20 Left 1034163226 7:149007373-149007395 CCAGTAGGACCTGGAAAGGCCCC 0: 1
1: 0
2: 0
3: 11
4: 143
Right 1034163237 7:149007416-149007438 GCTTCCCACCAGGAGCTGTGGGG 0: 1
1: 0
2: 2
3: 24
4: 233
1034163230_1034163237 -1 Left 1034163230 7:149007394-149007416 CCTTCACCCCAATCTCAGCTCTG 0: 1
1: 0
2: 8
3: 42
4: 436
Right 1034163237 7:149007416-149007438 GCTTCCCACCAGGAGCTGTGGGG 0: 1
1: 0
2: 2
3: 24
4: 233
1034163227_1034163237 11 Left 1034163227 7:149007382-149007404 CCTGGAAAGGCCCCTTCACCCCA 0: 1
1: 0
2: 0
3: 25
4: 261
Right 1034163237 7:149007416-149007438 GCTTCCCACCAGGAGCTGTGGGG 0: 1
1: 0
2: 2
3: 24
4: 233
1034163231_1034163237 -7 Left 1034163231 7:149007400-149007422 CCCCAATCTCAGCTCTGCTTCCC 0: 1
1: 0
2: 1
3: 51
4: 448
Right 1034163237 7:149007416-149007438 GCTTCCCACCAGGAGCTGTGGGG 0: 1
1: 0
2: 2
3: 24
4: 233
1034163232_1034163237 -8 Left 1034163232 7:149007401-149007423 CCCAATCTCAGCTCTGCTTCCCA 0: 1
1: 1
2: 5
3: 43
4: 586
Right 1034163237 7:149007416-149007438 GCTTCCCACCAGGAGCTGTGGGG 0: 1
1: 0
2: 2
3: 24
4: 233
1034163233_1034163237 -9 Left 1034163233 7:149007402-149007424 CCAATCTCAGCTCTGCTTCCCAC 0: 1
1: 1
2: 2
3: 59
4: 551
Right 1034163237 7:149007416-149007438 GCTTCCCACCAGGAGCTGTGGGG 0: 1
1: 0
2: 2
3: 24
4: 233
1034163228_1034163237 1 Left 1034163228 7:149007392-149007414 CCCCTTCACCCCAATCTCAGCTC 0: 1
1: 0
2: 4
3: 45
4: 472
Right 1034163237 7:149007416-149007438 GCTTCCCACCAGGAGCTGTGGGG 0: 1
1: 0
2: 2
3: 24
4: 233
1034163229_1034163237 0 Left 1034163229 7:149007393-149007415 CCCTTCACCCCAATCTCAGCTCT 0: 1
1: 0
2: 0
3: 29
4: 356
Right 1034163237 7:149007416-149007438 GCTTCCCACCAGGAGCTGTGGGG 0: 1
1: 0
2: 2
3: 24
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034163237 Original CRISPR GCTTCCCACCAGGAGCTGTG GGG Intronic
900115409 1:1025883-1025905 ACTTCCCACCAGGAGCCCCGGGG - Intronic
900184515 1:1326743-1326765 GCTTCCTCCCAGGAGCTGCCTGG - Intronic
900585985 1:3432545-3432567 GCTTCCCAGCTGGAGCAATGAGG + Intronic
900624906 1:3603632-3603654 GCTTGCCCCCAGGAGGTGGGAGG - Intronic
901028163 1:6290192-6290214 GCATCCTACCAGGAGCTGGAGGG - Intronic
901211671 1:7529995-7530017 GCCACCGACCAGGAGCTGAGTGG + Intronic
903122512 1:21225502-21225524 GCTTCTCACCAGGAGCAGGGAGG - Intronic
905874408 1:41422962-41422984 TGTTCCAACCAGAAGCTGTGTGG + Intergenic
906528951 1:46512330-46512352 GCTGCCCACCAGGGTGTGTGGGG + Exonic
907158238 1:52353633-52353655 CCTTCCATCCAGGACCTGTGAGG + Exonic
907869712 1:58432189-58432211 GATTCACACCAAGAGCTGTAGGG - Intronic
908793988 1:67813076-67813098 GCTTGCCATCTGGAGCTTTGGGG - Intronic
912956365 1:114156529-114156551 GGGTCCCACCAAGAGCTGGGAGG + Intergenic
913282838 1:117201973-117201995 GCTTTCCACCAGGACCTGTCTGG + Intronic
915297256 1:154929985-154930007 GTTTCCCTCCAGGAGCGTTGTGG + Intronic
915587681 1:156852932-156852954 GCTGACCTCCAGGAGCTGAGTGG + Intronic
915594000 1:156886151-156886173 GCTTCCCACCTGGATCTGAAGGG + Intergenic
915914674 1:159933839-159933861 ACTTCTTACCAGGTGCTGTGTGG - Intronic
916558225 1:165911052-165911074 ACTTCCCTCCAACAGCTGTGAGG - Intronic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
919328168 1:196135773-196135795 GTTGCCAGCCAGGAGCTGTGGGG + Intergenic
921164519 1:212496932-212496954 GGTTCCCTCTGGGAGCTGTGGGG + Intergenic
922098313 1:222461262-222461284 ACTGCCCACCTGGACCTGTGCGG - Intergenic
923318593 1:232805832-232805854 GCAGGCCCCCAGGAGCTGTGGGG - Exonic
1063652029 10:7947309-7947331 GCTTTCCATCAGCAGCTGTGAGG + Intronic
1063750025 10:8933792-8933814 GATTCCCTCCAAGGGCTGTGAGG + Intergenic
1065715365 10:28561707-28561729 GCTTCACAGCAGGAGGTGAGCGG + Intronic
1065966425 10:30774716-30774738 GGTTCCCGCAAGGAGTTGTGGGG - Intergenic
1067842210 10:49690065-49690087 GCTTCCCTGCAGGAGGTGAGCGG + Intronic
1069358304 10:67613192-67613214 GCTACGAACAAGGAGCTGTGAGG - Intronic
1069987067 10:72291808-72291830 GATCCCCAGCAGGAGATGTGGGG - Intergenic
1070721734 10:78761626-78761648 GCTTCCGACGGGGAGCTTTGGGG + Intergenic
1074279208 10:112035131-112035153 GCTTCACAGCAGGAGGTGAGTGG - Intergenic
1075083037 10:119396608-119396630 GATTTCCTCCAGGGGCTGTGAGG + Intronic
1075348584 10:121703411-121703433 GCTTCCTACCACAAGCTGCGTGG + Intergenic
1075964086 10:126595533-126595555 GCTCTCCACCAGAGGCTGTGTGG + Intronic
1076014292 10:127015366-127015388 GTCTCCCACCAGGAGCCCTGTGG + Intronic
1076435107 10:130435221-130435243 TGTTCCCACCAGAAGCTCTGGGG - Intergenic
1076732397 10:132445257-132445279 GTTTCCTCCCAGGAGCTGAGAGG + Exonic
1077305409 11:1866691-1866713 GCTGTCCACCAGGAGCTCTGTGG + Exonic
1077963153 11:7096883-7096905 GCTGCACAGCAGGAGCTGAGTGG + Intergenic
1079360493 11:19766680-19766702 GCTTCACATCTGGAGCTGAGAGG - Intronic
1083068378 11:59949433-59949455 CCTTCCCTCCAGGATCTGCGGGG - Intergenic
1083714412 11:64567511-64567533 ACCTCCCACCAGGAGCTGCCTGG - Intronic
1084912948 11:72406026-72406048 GCTTCCCACCAAAGGCAGTGAGG + Intronic
1086120878 11:83303625-83303647 CCTAGCCACCAGCAGCTGTGAGG + Intergenic
1086532883 11:87806968-87806990 GCTGCACACCAGGAGGTGAGTGG + Intergenic
1089301928 11:117504163-117504185 GTTGCCCACCAGGAGCCATGTGG - Intronic
1089305795 11:117525295-117525317 GATTCCCAGCAGGGGCTGGGAGG + Intronic
1089703596 11:120260653-120260675 GCTTCTCACTGGGAGCTGTTTGG + Intronic
1093810799 12:23490176-23490198 GCTTCACAGCAGGAGATGAGTGG + Intergenic
1094689175 12:32751840-32751862 GCTGCGCAACAGGAGCTGAGTGG - Intronic
1096121482 12:49091929-49091951 GGTGCCCAAGAGGAGCTGTGCGG + Intronic
1100577186 12:95903892-95903914 GCTTCACAGCATGAGTTGTGAGG + Intronic
1102855617 12:116290576-116290598 ACCTCCCACCAGCAGCTGAGAGG + Intergenic
1104894375 12:132154564-132154586 GCTGCCCACCAGGCGGTGTTAGG + Intergenic
1105278627 13:18950359-18950381 GCATCCCTCAAAGAGCTGTGTGG + Intergenic
1105811514 13:24000425-24000447 CCTCCCCACCAAGAGCTGTCTGG - Intronic
1107865654 13:44700803-44700825 GCTCTCTACCAAGAGCTGTGTGG - Intergenic
1110475081 13:75904160-75904182 GGTTCCCTCCAGGAGAGGTGAGG + Intergenic
1110803830 13:79732225-79732247 GCTTCCCACCTTGTTCTGTGAGG - Intergenic
1112029874 13:95447385-95447407 GCTGACCACCAGGAGCTGGAAGG - Intronic
1113774173 13:112933309-112933331 TCCTCCCACCAGGAGCTCCGTGG + Intronic
1123168020 14:106344897-106344919 GCTTCTCTCCCAGAGCTGTGCGG + Intergenic
1123170661 14:106369610-106369632 GCTTCTCTCCCAGAGCTGTGGGG + Intergenic
1124963846 15:34418836-34418858 AGTTCCCAACAGGTGCTGTGGGG + Intronic
1128065724 15:64763330-64763352 GCTTCCTGCAAGGAGCTCTGGGG + Intronic
1128252377 15:66172282-66172304 GCCTCCCTCCAGGAGCTGGAAGG + Intronic
1129663810 15:77568089-77568111 GCTTCTCACCAGCAGGTCTGGGG - Intergenic
1129856320 15:78827843-78827865 ACATGCCACCAGGAGCTGGGAGG - Intronic
1131856864 15:96606330-96606352 GCTTCCCATCTTGAGCAGTGTGG + Intergenic
1131994401 15:98120208-98120230 GGATCTCACAAGGAGCTGTGAGG + Intergenic
1132353359 15:101154340-101154362 GCTTCCCACCTGGGGCTCTAGGG - Intergenic
1132506294 16:310958-310980 GCTTCTCTCCAGGAGCTGGCAGG + Intronic
1132799268 16:1743648-1743670 GCTGCCCAGCAGGCCCTGTGTGG + Intronic
1132948935 16:2549403-2549425 GCATCCCTCCAGGGGATGTGAGG + Intronic
1132965652 16:2652724-2652746 GCATCCCTCCAGGGGATGTGAGG - Intergenic
1136933201 16:34436750-34436772 TCTTCCCAGCAGGAGCAGGGAGG + Intergenic
1136971371 16:34975064-34975086 TCTTCCCAGCAGGAGCAGGGAGG - Intergenic
1139415028 16:66801309-66801331 TCTTCCCGCCAAGGGCTGTGGGG + Intronic
1140058633 16:71547790-71547812 GCTTCCCACAGGGAGTTGGGAGG - Intronic
1141689706 16:85589160-85589182 GCTTCCTAGCAGGAGCTGAAAGG + Intergenic
1141890061 16:86920300-86920322 TCTTGCCAGCAGGAGCTCTGTGG + Intergenic
1142390204 16:89794647-89794669 GGCTCCCAACAGGTGCTGTGAGG - Intronic
1142407895 16:89901354-89901376 GCCTCCTCCGAGGAGCTGTGAGG + Intronic
1145028907 17:19489699-19489721 GCAGCACACCAAGAGCTGTGGGG - Intergenic
1145262177 17:21360992-21361014 GCTCCCCACCCAGAGCTCTGAGG - Intergenic
1146213095 17:30957119-30957141 GTTTCCCCCAAGGGGCTGTGCGG - Intronic
1146607137 17:34270518-34270540 TCTACCCAACAGCAGCTGTGTGG - Intronic
1146789046 17:35741430-35741452 GCTTCTCACCGGGAGGTGCGTGG - Exonic
1147224644 17:38967343-38967365 GCTTCCCGCCAGGAGGCGAGAGG + Exonic
1148356308 17:46978141-46978163 GCTTCCCACCCGCGCCTGTGAGG - Exonic
1148630043 17:49100350-49100372 CCTCCCCACCAGTAGGTGTGTGG + Intergenic
1149323841 17:55509672-55509694 TCTTTCCATCAGGACCTGTGTGG - Intergenic
1149379452 17:56078771-56078793 GGTTCTCTCCAGAAGCTGTGTGG + Intergenic
1152072480 17:78140774-78140796 GCTTCCCACGAGCGGGTGTGAGG - Intronic
1154146895 18:11874120-11874142 GCTTCCGTCCAGGGGCTGAGGGG + Intronic
1155368231 18:25070748-25070770 GCTTCCCACCAAGAGATATGTGG - Intronic
1156470024 18:37371655-37371677 TCTTGCCACCAGGAGCTGGGAGG + Intronic
1157449937 18:47778405-47778427 GCTGCCCAGCAGGAGGTGAGTGG - Intergenic
1158132706 18:54170691-54170713 GCTGCCCTCCAGGAGGTGTTTGG + Intronic
1158827124 18:61235239-61235261 GGTTTCCACCAAGGGCTGTGAGG + Intergenic
1160846458 19:1168264-1168286 GCTACCCGCCAGGAGCTTGGGGG - Intronic
1160878443 19:1308650-1308672 GGCTCCCACCAGGCACTGTGGGG + Intergenic
1161748273 19:6075035-6075057 GCTTCCCACCATGTGATGTGAGG + Intronic
1162202672 19:9032468-9032490 GCTCCCCAGCAGAAGCTGTATGG + Intergenic
1163673957 19:18646020-18646042 TCTTCCTAGCAGGAGCTGGGGGG - Intronic
1165029321 19:32986122-32986144 GCTTTCCACCACCAGTTGTGTGG - Intronic
1165046402 19:33108304-33108326 GCTCCCCACGAGGCCCTGTGCGG + Intronic
1165088165 19:33365822-33365844 GCTGCCCAGCAGGAGATGAGTGG + Intergenic
1165099204 19:33428504-33428526 GCTGCCCTTCAGGAGCTGGGAGG + Intronic
1166336632 19:42112177-42112199 ACTGCCCACCTGGAGGTGTGTGG - Intronic
1166952508 19:46438961-46438983 AGTCCCCACCAGGAGCTTTGAGG - Intergenic
1166952703 19:46440375-46440397 AGTCCCCACCAGGAGCTTTGAGG - Intergenic
1168404901 19:56105598-56105620 GCTTCCCCCGAGAAGCTGGGTGG - Intronic
925117596 2:1393448-1393470 TCTTCCACCCAGGTGCTGTGTGG - Intronic
925177628 2:1796548-1796570 CCCTCGCACCAGGAGCTGGGGGG + Intronic
925190220 2:1876459-1876481 GGGTCCCTGCAGGAGCTGTGTGG - Intronic
926704199 2:15825351-15825373 CCTTCCCACCAGGAGCTAGAGGG - Intergenic
928254633 2:29711463-29711485 GCTTCCCTCAAGGAGCTCTGGGG - Intronic
928410049 2:31047878-31047900 GACACACACCAGGAGCTGTGGGG + Intronic
929899478 2:45988491-45988513 GCATACAACCAGGAACTGTGGGG + Intronic
930838813 2:55824539-55824561 GCCTCCCACCAGGAGTGGTACGG + Intergenic
932839084 2:75064876-75064898 ACTTACCACTAGGAGCTTTGTGG - Intronic
933158707 2:79001438-79001460 ACTTCCCACCTGCACCTGTGTGG + Intergenic
934737191 2:96695549-96695571 GAATTCCACCAGGAGCTGGGGGG - Intergenic
934757387 2:96833467-96833489 GCCTCCCTGCAGGTGCTGTGTGG + Exonic
936057732 2:109273423-109273445 GCCTGCCCCCAGGAGGTGTGCGG + Intronic
936091183 2:109502214-109502236 GGTTCCCAACAGGGGCGGTGGGG - Intronic
936288775 2:111201530-111201552 TCTTCCCTCCAGCAGCTGGGAGG - Intergenic
938147429 2:128848442-128848464 GCTTCCCAGCAGCTGCTGTGGGG + Intergenic
938422140 2:131154382-131154404 ACATCCCACTAGGTGCTGTGGGG - Intronic
941784998 2:169488553-169488575 GCTGCCCAGCAGGAGGTGAGTGG - Intronic
942983867 2:182115486-182115508 GTTTACCACAAGGAGTTGTGAGG + Intronic
943058921 2:183017589-183017611 GCTGCCCAGCAGGAGATGAGTGG - Intronic
943906636 2:193507393-193507415 GCTTGCCACCAGGAGGCTTGAGG + Intergenic
944690868 2:202157334-202157356 CCTCCACACCTGGAGCTGTGTGG + Intronic
948551968 2:238778788-238778810 GCTTCCCAACTGGAGATGTGGGG - Intergenic
948724000 2:239920641-239920663 GCTTCCTTCCAGAAACTGTGTGG - Intronic
1170692863 20:18630934-18630956 GCATCCTACCAGGAGGTATGTGG + Intronic
1170951478 20:20940140-20940162 GGGTTCCACCAGGAGCTCTGAGG - Intergenic
1171170480 20:23011310-23011332 GTTTCTCACCAGGAACTCTGGGG - Intergenic
1171226012 20:23442720-23442742 TCTTCCTCCCAGGAGCAGTGTGG + Intronic
1172151954 20:32796929-32796951 CCTTCCCAACAGCACCTGTGTGG + Intronic
1172976461 20:38909700-38909722 GCTTCCCAGCACGAACAGTGGGG + Intronic
1173595728 20:44257605-44257627 CCCCCCCACCAGGAGCAGTGGGG + Intronic
1174039649 20:47689876-47689898 GCCTCCCACCAAGAGGTGTGTGG - Intronic
1175287820 20:57849587-57849609 GCTGCACAGCAGGAGCTGAGTGG + Intergenic
1175667421 20:60872117-60872139 GGTTCCCACCAGGTGCCCTGAGG - Intergenic
1175735805 20:61386244-61386266 TGTTCCTTCCAGGAGCTGTGAGG - Intronic
1175902276 20:62364694-62364716 GATGCCCACCTGGGGCTGTGAGG + Intronic
1177296310 21:19180989-19181011 GGTACCCACCAGGTGGTGTGGGG - Intergenic
1178496968 21:33094954-33094976 GAGTCCCACCAGCAGCTGTGAGG + Intergenic
1180102487 21:45595312-45595334 GGTTCCCACCAACAGCTGAGGGG + Intergenic
1181466405 22:23112878-23112900 TCTGCCCAGCTGGAGCTGTGGGG - Intronic
1181771410 22:25128380-25128402 GCTTCACACCAGGTGTTGGGTGG + Intronic
1183371593 22:37435611-37435633 CCTTCCTACCAGGGGCTGAGTGG + Intergenic
1184032057 22:41900922-41900944 GCTGCCCGCCAGGAGGTATGCGG - Intronic
1184279420 22:43428520-43428542 GCTCCCTCCCAGGAGCGGTGGGG + Intronic
1184279557 22:43429240-43429262 GATTCCCACCCAGTGCTGTGTGG + Intronic
1184550060 22:45199716-45199738 GCAGCCCTCCAGGAGCTGAGGGG - Intronic
1184697284 22:46147181-46147203 GCCACCCCCCTGGAGCTGTGGGG + Intergenic
1185208906 22:49555639-49555661 GGTTCCCTCCAAGAGCTGTGAGG - Intronic
949420950 3:3865039-3865061 GTTTCCAAGCAGGAGCTGGGAGG - Intronic
950450752 3:13063756-13063778 GCATCCCACCAGGGGCACTGGGG - Intronic
950526808 3:13529090-13529112 GCTGCACAGCAGGAGCTGCGTGG - Intergenic
950611023 3:14126512-14126534 TCTTCCACCCAGTAGCTGTGTGG + Intronic
951207807 3:19942883-19942905 GCTGCCCAGCAGGAGGTGAGTGG - Intronic
952635385 3:35523024-35523046 GCTACTCACCACGTGCTGTGTGG + Intergenic
954466291 3:50656997-50657019 ACTTCCCACCTGAAGCTGGGAGG + Intergenic
954966528 3:54616321-54616343 GCTTCCAACCAACAGCTGTCAGG - Intronic
955289244 3:57675634-57675656 GCTTCCTTGCAGGGGCTGTGGGG - Intronic
957484812 3:80845818-80845840 GGTGATCACCAGGAGCTGTGGGG - Intergenic
960946736 3:122972091-122972113 GCTTCCTACCTGGAGCAGTGAGG - Intronic
961000478 3:123370848-123370870 CCTTCCCACCACGTGCTCTGGGG + Intronic
963706596 3:148696237-148696259 GCTTCTCACCACTTGCTGTGTGG - Intergenic
965304853 3:167051581-167051603 GCTTCACAGCAGGAGGTGAGCGG + Intergenic
968863989 4:3195979-3196001 GCTTCCCAGCAGCAGCACTGTGG + Intronic
968889982 4:3363740-3363762 GGTTCCCAACAAGAGCTGGGAGG + Intronic
969289537 4:6229891-6229913 GCAGCCCACAAGGCGCTGTGTGG + Intergenic
969378112 4:6776501-6776523 GCCTCTCATCAGGAGCGGTGGGG + Intergenic
969864782 4:10067683-10067705 ACATCCCACCAGGGCCTGTGGGG + Intergenic
973861148 4:55066257-55066279 ACGTCCCACCAGGAGCTGTGTGG - Intergenic
974184781 4:58431338-58431360 GCCTGCCACCAGTAGCAGTGTGG - Intergenic
978382535 4:108144657-108144679 CCTGCCCTCCAGCAGCTGTGTGG - Intronic
980230372 4:130039424-130039446 GCTTCACAGCAGGAGGTGAGTGG + Intergenic
980870664 4:138607846-138607868 GCTTCCCACCCACAGCAGTGAGG + Intergenic
981755899 4:148141668-148141690 GCTGCCCACCACCTGCTGTGTGG - Intronic
982966026 4:161909217-161909239 GATCCCCACCAGGAGCTCTGTGG + Intronic
984262556 4:177459206-177459228 GTTTCCCTCTAGGAGATGTGAGG + Intergenic
984819485 4:183867816-183867838 GCTTCCCCCTTGGGGCTGTGAGG - Intronic
985382155 4:189406007-189406029 GCTTCCCCAAAGGGGCTGTGGGG - Intergenic
985696111 5:1341316-1341338 GCTTCTCACCAGGAGCTCTGGGG - Intronic
987051587 5:14151071-14151093 CTTTCGCACCAGGAACTGTGAGG - Intronic
989585449 5:43071035-43071057 GTTTCCCACCAGAAGTTGGGTGG - Intronic
992093351 5:73338973-73338995 CTTTCCCACCAGGATCAGTGAGG - Intergenic
992344242 5:75860072-75860094 GGTACCCACCAGGTGGTGTGGGG + Intergenic
994756936 5:103805403-103805425 ACTCCTCACCAGGAGCTATGAGG - Intergenic
995339710 5:111044378-111044400 GCTGCACAGCAGGAGGTGTGTGG - Intergenic
995879607 5:116829733-116829755 GCTTTCCCACAGGAGCTGTGGGG + Intergenic
995952492 5:117732926-117732948 GCTTCACATCAGGAGGTGAGCGG - Intergenic
997377341 5:133406476-133406498 TCTTCCCACCAGCAGCCCTGAGG - Intronic
997443849 5:133927205-133927227 GCTGCCCTCCTGGAGCTGAGTGG - Intergenic
1003120933 6:3318576-3318598 GCTTCCCAGGAGGCCCTGTGTGG + Intronic
1006131856 6:31874451-31874473 GCTTCTCACCTGGAGCAGAGGGG + Exonic
1007321263 6:41030400-41030422 GCCTCCCACCTGGGGCTTTGCGG - Exonic
1008584156 6:52933870-52933892 GGTCCCCACCAGGGGCTGTGGGG + Intergenic
1010717478 6:79246132-79246154 GCTGCACAGCAGGAGCTGAGTGG + Intergenic
1011516140 6:88156034-88156056 ACTTCCCACCATGAGCCATGAGG + Intronic
1015226349 6:130861530-130861552 GCTTGTCACCAGAAGCTGTTGGG - Intronic
1017257969 6:152355521-152355543 CCTGCCCACCAGGTGCTCTGAGG + Intronic
1018451655 6:163914084-163914106 GCATCCCAACAGAAGCTGTGAGG - Intergenic
1018978494 6:168583387-168583409 GCTTCAGACCAGGAGGGGTGAGG - Intronic
1019646039 7:2129434-2129456 GCTGCCTAGCAGGAGCCGTGTGG - Intronic
1019788001 7:2991500-2991522 CCTTCCCACCAGAAGCTGTTGGG - Intronic
1020250734 7:6466358-6466380 ACTGCCCACCAGGAGCTCAGAGG + Intronic
1021203350 7:17751485-17751507 GCTTCTCAGCAGCAGCTGTTTGG + Intergenic
1024626696 7:51213834-51213856 GCTTGGCCCCAGGAGGTGTGTGG - Intronic
1025635862 7:63318412-63318434 GCTGCTCTCCAGGAGCTTTGAGG + Intergenic
1025646834 7:63429768-63429790 GCTGCTCTCCAGGAGCTTTGAGG - Intergenic
1027180988 7:75939138-75939160 GCTGCACTCCAGGAACTGTGTGG - Intronic
1028768641 7:94589525-94589547 GCTGCCCAGCAGGAGGTGAGTGG + Intronic
1031490431 7:122381143-122381165 GCTTTCAGCCAGGAGCTGGGGGG - Intronic
1032604132 7:133330685-133330707 CCTACCCAACAGAAGCTGTGAGG - Intronic
1033620994 7:143061891-143061913 GCTTCCATCCAGGAGCGGTCAGG + Intergenic
1034163237 7:149007416-149007438 GCTTCCCACCAGGAGCTGTGGGG + Intronic
1034679862 7:152920430-152920452 GCTTCCCACCAGCACCCGAGGGG - Intergenic
1035276491 7:157751060-157751082 GCTCCCCGCCAGGATCTGGGAGG - Intronic
1038866963 8:31449528-31449550 GCTTCACAGCAGGAGGTGAGTGG - Intergenic
1038965660 8:32568610-32568632 GCTTCATTCCAGGAGCTCTGGGG - Intronic
1039276541 8:35938800-35938822 AATTCCCAACAGTAGCTGTGGGG + Intergenic
1044523599 8:93226805-93226827 GCTTCCCTACAAGTGCTGTGAGG + Intergenic
1046031210 8:108785857-108785879 GCTTCCCCCATGGAGCAGTGAGG - Intronic
1046233341 8:111387368-111387390 GCTGCCCTGCTGGAGCTGTGTGG - Intergenic
1047419231 8:124692778-124692800 GCTTCCCACCAGGATCCATGAGG + Intronic
1047775570 8:128067619-128067641 TCTTCCCAGAAGGAGGTGTGGGG + Intergenic
1048527081 8:135213051-135213073 GCTGCCCAGCATGGGCTGTGAGG + Intergenic
1049056138 8:140239011-140239033 GCTTCCCACCAGGAGCTCACTGG + Intronic
1049239256 8:141528665-141528687 GCTTCCAACCCGGGCCTGTGTGG + Intergenic
1049357791 8:142197184-142197206 GCTTTCCACCAGCAGCGGGGTGG - Intergenic
1053358125 9:37464639-37464661 GCTTCGTGCGAGGAGCTGTGGGG - Intronic
1055846408 9:80568907-80568929 GCTGCCCAGCAGGAGGTGAGTGG - Intergenic
1056978829 9:91288038-91288060 GCCTCCCCCCAGAAGCTGGGGGG + Intronic
1059423668 9:114207616-114207638 GCTTCCCACCCAGGGCTGTGTGG - Intronic
1059997567 9:119927114-119927136 GAATACCAACAGGAGCTGTGAGG - Intergenic
1060354616 9:122893532-122893554 ACTTAACAGCAGGAGCTGTGTGG + Intronic
1060796566 9:126516088-126516110 CCCTCCCACCAGGAGTTCTGAGG - Intergenic
1061727019 9:132587599-132587621 GGTCCCCTCCAGGAGCTGTGAGG - Intronic
1187968043 X:24632016-24632038 GGTTCCCACCAGGTGCCCTGAGG + Intronic
1188323639 X:28772503-28772525 GCTTTCCGCCAGGAAATGTGAGG + Intronic
1189344227 X:40228366-40228388 GCTGCCCAGCAGGAGGTGAGTGG - Intergenic
1190302247 X:49063849-49063871 GCCTCCCACCAGGAGCTGACTGG + Exonic
1190431276 X:50379854-50379876 CCTTCCTCCCATGAGCTGTGAGG + Intronic
1190642258 X:52492293-52492315 CCTTCCCATCAAGAGCTGTTTGG + Intergenic
1190645415 X:52520574-52520596 CCTTCCCATCAAGAGCTGTTTGG - Intronic
1192349451 X:70345059-70345081 GCTTCAAACCAGGGTCTGTGTGG - Intronic
1196887727 X:120263543-120263565 GCTTCTCTCCAGGAGCCTTGTGG + Intronic
1199018675 X:142848960-142848982 GTTCTCCACCAGCAGCTGTGTGG - Intergenic
1200235942 X:154467759-154467781 GCCACCCACCAGCACCTGTGGGG - Exonic
1200258036 X:154595829-154595851 GCTCCTCACCAGGATCTCTGAGG - Intergenic