ID: 1034164538

View in Genome Browser
Species Human (GRCh38)
Location 7:149015180-149015202
Sequence AAAACTGCAGAGATGCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 374}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034164538_1034164542 2 Left 1034164538 7:149015180-149015202 CCTGGCTGCATCTCTGCAGTTTT 0: 1
1: 0
2: 4
3: 39
4: 374
Right 1034164542 7:149015205-149015227 GGACACAGCCAAGAGTCAGAAGG 0: 1
1: 0
2: 1
3: 22
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034164538 Original CRISPR AAAACTGCAGAGATGCAGCC AGG (reversed) Intronic
900379284 1:2375837-2375859 AACACTGCAGGAATGCAGCCGGG - Intronic
900409776 1:2507344-2507366 AAGGCTACAGAGATGCAGGCTGG + Intergenic
901770314 1:11526872-11526894 AAAAGGGCAAAGAAGCAGCCGGG - Intronic
901971340 1:12911517-12911539 GAGACTGGAGAGGTGCAGCCAGG - Intronic
902013827 1:13290223-13290245 GAGACTGGAGAGGTGCAGCCAGG + Intergenic
902517808 1:16999083-16999105 GAAACAGCTCAGATGCAGCCAGG + Intronic
902552040 1:17224941-17224963 AAGACTCCAGAGAGGCAGCCTGG + Intronic
903048394 1:20582318-20582340 AAAAATGCAAAGAATCAGCCGGG + Intergenic
903133401 1:21293594-21293616 AAATCAGCAGAGATGGAGCCTGG + Intronic
904089866 1:27937279-27937301 CTAACTGCAGAGAAGCAGACAGG + Intronic
904437334 1:30507352-30507374 ACAGCTGCAGATATGCAGCATGG - Intergenic
904525762 1:31132716-31132738 AAAATTGCAAAGATGCAGCCAGG + Intergenic
904923373 1:34026582-34026604 TAAAATGCAGAGGTGCAACCAGG + Intronic
905106139 1:35564650-35564672 GGGGCTGCAGAGATGCAGCCTGG - Intronic
908066574 1:60412691-60412713 AAAACTGTAGACATGAAGCCAGG + Intergenic
908834172 1:68211882-68211904 AAAATTTCCCAGATGCAGCCAGG - Intronic
909626186 1:77718718-77718740 GAAAATGCAGAGATCCAGCCTGG + Intronic
909951110 1:81721652-81721674 GAAGCTGAAGAGCTGCAGCCCGG - Intronic
911099094 1:94079907-94079929 AAAACTGAAAAGAGGCAGCAAGG - Intronic
911679764 1:100701939-100701961 AAAAGTTCAGAGTTACAGCCTGG - Intergenic
912259460 1:108095870-108095892 ATGACTGCAAAGTTGCAGCCAGG - Intergenic
913014388 1:114717956-114717978 AATAATGCACAGTTGCAGCCTGG - Exonic
914408516 1:147402100-147402122 GAATCTGCATTGATGCAGCCAGG - Intergenic
914887106 1:151594415-151594437 AAAACTACAGAGACCCAGGCAGG - Intergenic
915740002 1:158112068-158112090 AGAAATGGAGAGAAGCAGCCAGG - Intergenic
918991515 1:191702695-191702717 AAATCTACAGTGAAGCAGCCAGG + Intergenic
919041210 1:192390831-192390853 AAAACTGACAAGAGGCAGCCGGG - Intergenic
921125426 1:212173471-212173493 GGAACTGCAGAATTGCAGCCTGG + Intergenic
922037289 1:221861332-221861354 AAAACTGCAGCAAGGCAGACTGG - Intergenic
922532770 1:226357115-226357137 AAAACTGCAGCGTCTCAGCCGGG + Intergenic
923021515 1:230167735-230167757 AAATGTGCAGGGCTGCAGCCTGG + Intronic
924154630 1:241163448-241163470 AAATCTGCATTGATGTAGCCAGG + Intronic
924515155 1:244759916-244759938 GAAACTCCTGAGATGCAGGCTGG + Intergenic
924859720 1:247908633-247908655 AAATCTGCATTGATGCAGCCAGG - Intergenic
1063081717 10:2773504-2773526 AAAACAGGAGAGAGGCAGGCGGG + Intergenic
1064206009 10:13324125-13324147 AAAACTGTAGAGATGCAGAAAGG - Intronic
1064692175 10:17929520-17929542 AAATCCGCACTGATGCAGCCTGG + Intergenic
1066816697 10:39427392-39427414 AAAACTGCAAAGAAGCATTCTGG - Intergenic
1067078802 10:43202661-43202683 AAAGCTGCAGAGTTGCGGGCTGG - Intronic
1067177831 10:43962575-43962597 AGTACTGCACAAATGCAGCCGGG + Intergenic
1070201325 10:74208335-74208357 ACAATTGGGGAGATGCAGCCAGG - Intronic
1071614858 10:87066066-87066088 AATGCTGAAGAGATGCAGGCTGG - Intronic
1071827680 10:89341304-89341326 AAAAGGGCAGAGATCCATCCAGG + Intronic
1072195058 10:93110386-93110408 AAATCTGCACAGATGCAGCCAGG - Intergenic
1072426218 10:95333099-95333121 AAATCTGCATTGATGCAGCCAGG + Intronic
1072742881 10:97920724-97920746 ACATCTGAGGAGATGCAGCCTGG - Intronic
1074378159 10:112955806-112955828 AGAACTGCAGCGATCCAGCACGG - Intronic
1074858469 10:117491132-117491154 AACTCTGGAGAGGTGCAGCCAGG - Intergenic
1074863736 10:117532825-117532847 CAAACTGCAGGGCTCCAGCCTGG - Intergenic
1074895626 10:117775149-117775171 GAATCTCCAGAGGTGCAGCCTGG + Intergenic
1076510397 10:131009899-131009921 AAAGCTGCAGTGATGCAGTGTGG - Intergenic
1077460063 11:2704615-2704637 AGAACTGAAGAGAGGCAGCAGGG + Intronic
1077902528 11:6500933-6500955 CCACCTGCAGAGAAGCAGCCAGG - Intronic
1078053944 11:7991864-7991886 AAAACTGCAGAGGGACAGCTTGG - Intronic
1078397165 11:10991495-10991517 AAAACTGCAGAGAGCCAGGCAGG - Intergenic
1078987949 11:16613147-16613169 AAAACAGCTGGGATGCAGACGGG + Intronic
1079037561 11:17034225-17034247 CAAACTGCAAGGAGGCAGCCAGG - Intergenic
1081912574 11:46709323-46709345 AACACTGCATGGATGCAGCCAGG - Intergenic
1083355889 11:62065816-62065838 AAAACAGCAGAGATTTAGGCCGG + Intergenic
1083823515 11:65185474-65185496 AAATCTGCATTGATGTAGCCAGG - Intronic
1084214914 11:67641938-67641960 CCAACTGCAGAGATGCAGGGAGG - Intergenic
1084417911 11:69044110-69044132 AAAACTAGAGAGACACAGCCAGG - Intergenic
1084421953 11:69064632-69064654 AAAGCAGCAGAGATGCAGCGTGG - Intronic
1084645587 11:70455554-70455576 AAAACTGGAGAAATGATGCCTGG - Intergenic
1088776155 11:113085383-113085405 ATAACTGCAGAGCTGGAGGCAGG - Intronic
1088949838 11:114556502-114556524 AAAACTGCAGACTTGCAGCCTGG - Intronic
1089765002 11:120756815-120756837 AAGCCTGCAGAGAAGCTGCCAGG - Intronic
1089840292 11:121411368-121411390 GAATCTGCATTGATGCAGCCAGG - Intergenic
1090267949 11:125365755-125365777 AAATGTGGAGAGATGCAGCCTGG - Intronic
1090835990 11:130454230-130454252 AAGACTGCAAAGATCCTGCCTGG - Intronic
1090874756 11:130778578-130778600 AAACCTGGAGAGCTGCACCCTGG + Intergenic
1091927973 12:4370873-4370895 AGAACTGCAGAGCTTCAGGCCGG - Intronic
1093069989 12:14698787-14698809 GAAACTGAAGAGCTACAGCCTGG + Intergenic
1093376963 12:18441062-18441084 AAAACTGAAGAGAAGCAGTCAGG + Intronic
1094451640 12:30588762-30588784 CAAACTGCAAAGCGGCAGCCAGG + Intergenic
1095058846 12:37657147-37657169 AAAACTACACAGATGCATTCTGG + Intergenic
1095421801 12:42031848-42031870 ACCACTGCAGAAATGCAGGCAGG - Intergenic
1096939799 12:55330068-55330090 AATACAGCAGAGATGTGGCCTGG + Intergenic
1097597714 12:61654515-61654537 AAATTTGCAGTGGTGCAGCCGGG - Intergenic
1097599052 12:61669576-61669598 GAATCTGCATTGATGCAGCCAGG - Intergenic
1097757465 12:63422701-63422723 AAAAATGCAGAGGTGCAGAGAGG + Intergenic
1100219756 12:92492255-92492277 AAAAGTGCAGAGTAGCAGTCCGG + Intergenic
1102627934 12:114251122-114251144 AAATCTGCATTGATGCAGCCAGG - Intergenic
1103803623 12:123555858-123555880 AACACTGCAGGGAACCAGCCGGG + Intergenic
1104361878 12:128140924-128140946 AAAACTCCAGAGATGGATTCAGG - Intergenic
1105477541 13:20741080-20741102 AAATCCTCAGAGATTCAGCCTGG + Intronic
1106052521 13:26204978-26205000 TAAGCTGCAGAGCTGAAGCCTGG + Intronic
1106289445 13:28347170-28347192 TAATCTGCAGAGATGAAGGCAGG + Intronic
1106501154 13:30330281-30330303 AAATATACAGAAATGCAGCCCGG - Intergenic
1108047994 13:46401499-46401521 AAATCTGCATTGATGCAACCAGG + Intronic
1108523801 13:51268131-51268153 ACAACTGCAGGAATGCAGCTGGG - Intronic
1109019695 13:57072931-57072953 AAAACTTCAGATGTGGAGCCTGG - Intergenic
1109163418 13:59003977-59003999 AGAAATCCAGAGAGGCAGCCTGG + Intergenic
1109370135 13:61412870-61412892 ATTACAGCAGGGATGCAGCCTGG + Exonic
1109561004 13:64050056-64050078 AAATCTGCATTGATGCAGCTAGG - Intergenic
1110441083 13:75525712-75525734 AGACCTGCAGAAATGCAGACAGG + Intronic
1110784803 13:79511157-79511179 AAATCTACATTGATGCAGCCAGG - Intronic
1110813851 13:79840069-79840091 CAAACTGCAAAGTGGCAGCCAGG + Intergenic
1111381580 13:87460570-87460592 TCAACTGCAGAGATGCACCCAGG - Intergenic
1111404125 13:87779756-87779778 AAAACTGAAGAAAGACAGCCAGG - Intergenic
1111536630 13:89610624-89610646 AGAACACCAGACATGCAGCCTGG + Intergenic
1112499277 13:99930014-99930036 AAGAATGCAGACATGCAGCATGG + Intergenic
1113824286 13:113238835-113238857 ATAACTACTGAGAGGCAGCCAGG - Intronic
1114418668 14:22561324-22561346 AAACCACCAGAGAGGCAGCCTGG - Intergenic
1114565802 14:23631915-23631937 CAACCTGCAGAGATGAAGTCAGG - Intronic
1115406431 14:33022072-33022094 GAGGCTACAGAGATGCAGCCTGG - Intronic
1116322825 14:43492583-43492605 CAAACTGCAAAGCGGCAGCCAGG + Intergenic
1116847435 14:49878267-49878289 AAAATTGTAGAGATGGAGCCAGG + Intergenic
1117707146 14:58482106-58482128 AAAAGTTCAGAGATGCCGGCCGG - Intronic
1118439429 14:65799296-65799318 AAAACTGAACAGTTTCAGCCAGG + Intergenic
1119347869 14:73941279-73941301 AAAACTGCAAAAATGTAGCTGGG - Intronic
1119535187 14:75397092-75397114 CAAAATGCAGAGATACTGCCTGG + Intergenic
1120265718 14:82248389-82248411 AAATCTGCACTGAGGCAGCCAGG + Intergenic
1121698165 14:95929622-95929644 AAAGCTGCCGAGATGCAGACAGG + Intergenic
1122002439 14:98671027-98671049 CAAACTGCAGAGGTGCCACCGGG - Intergenic
1122758420 14:104001261-104001283 GAAGCTGCAGAGATGAAGACGGG - Intronic
1123485520 15:20733144-20733166 AAAACTTCAGAGAAGCAATCTGG + Intergenic
1123542007 15:21302192-21302214 AAAACTTCAGAGAAGCAATCTGG + Intergenic
1123886083 15:24729444-24729466 AAAGCTCTAGAGCTGCAGCCTGG + Intergenic
1123893355 15:24803239-24803261 AAAAGTTCAGAGCTGCAGCTGGG + Intergenic
1125976109 15:43953251-43953273 AAAACTGCACAGATTCTGCAAGG + Intronic
1125998880 15:44190476-44190498 AAACTTGCAGAGATGGAGGCAGG + Intronic
1126030748 15:44495263-44495285 AAAAATTAAGAAATGCAGCCAGG - Intronic
1127120449 15:55767420-55767442 AAGACTGCAGATATTCAGCATGG - Intergenic
1127502284 15:59565420-59565442 AAAACCGCAGAAATGCAGTTGGG - Intergenic
1127948091 15:63775740-63775762 CAAACTGGTGAAATGCAGCCGGG + Intronic
1129363352 15:75038477-75038499 ATAACTGCTCAGATACAGCCTGG + Intronic
1129465683 15:75723027-75723049 AAAATAGCAGAGATGGAACCAGG - Intergenic
1129898994 15:79131059-79131081 AAATCTGCATTGATGCTGCCAGG + Intergenic
1130435096 15:83890209-83890231 AAAACTGAAGGAATGCAGCATGG + Exonic
1131464719 15:92645920-92645942 AAAACTCCAGCCATGCAGCTGGG - Intronic
1132090414 15:98943672-98943694 AACATTGCAGAGAGGCAGTCAGG + Intronic
1132152999 15:99475540-99475562 AAGACTGAAGAGGTGCAGCCAGG - Intergenic
1202950325 15_KI270727v1_random:29334-29356 AAAACTTCAGAGAAGCAATCTGG + Intergenic
1132850153 16:2021320-2021342 AAAAAGGCAGAGGAGCAGCCAGG - Intergenic
1134022829 16:10933284-10933306 AACTCTGCAGAGAAGCTGCCTGG + Intronic
1134138350 16:11695713-11695735 GACAGTGAAGAGATGCAGCCAGG - Intronic
1134330857 16:13250027-13250049 AGAAATGCAGAGATGTGGCCAGG - Intergenic
1134608485 16:15589636-15589658 AAGACTGGAGTGGTGCAGCCAGG - Intronic
1135712604 16:24730089-24730111 AAAGCTGCGGGGCTGCAGCCCGG - Intronic
1137352546 16:47726243-47726265 AGAAATGCAGAGAAACAGCCCGG - Intergenic
1137360110 16:47806639-47806661 AAAACTACAGGGCTGCAGGCTGG - Intergenic
1137380903 16:47998768-47998790 GTAAGAGCAGAGATGCAGCCAGG - Intergenic
1138276919 16:55741752-55741774 AAACCTGGAGAGAAGCAGACAGG - Intergenic
1138286129 16:55811676-55811698 AAACCTGGAGACAAGCAGCCAGG + Intronic
1139370600 16:66466863-66466885 AAAACTTGTGAGATGCAGGCTGG - Intronic
1139667137 16:68465263-68465285 TAAAAAGCAGAGAAGCAGCCAGG - Intergenic
1140065672 16:71609335-71609357 AAATCTGCCTTGATGCAGCCAGG + Intergenic
1141404236 16:83777530-83777552 AAAACTGCTGAGAAGCAGCTTGG + Intronic
1141647605 16:85375969-85375991 AGAACTGCTGGGCTGCAGCCAGG - Intergenic
1141806078 16:86342393-86342415 GAAACTGCAGAGGTGGGGCCCGG + Intergenic
1142512792 17:408268-408290 AAAACTGCTGTGCTCCAGCCTGG - Intergenic
1142585279 17:968410-968432 AAAGATACACAGATGCAGCCCGG + Intronic
1143205909 17:5139164-5139186 AGGACTCCAGAGATGCAGGCAGG + Intronic
1145021312 17:19433600-19433622 AAATCTGCACTGATGAAGCCAGG - Intergenic
1145089354 17:19973906-19973928 AAAAATCCAAAAATGCAGCCGGG + Intronic
1145405415 17:22586197-22586219 CAATCTGCATTGATGCAGCCAGG - Intergenic
1146688816 17:34859005-34859027 AGCCCTGCAGAGAAGCAGCCTGG - Intergenic
1147549826 17:41432811-41432833 AAAACAGCAGAGATGGCTCCTGG - Intergenic
1149864847 17:60145610-60145632 AATACAGCAGAGATCCAGGCTGG + Intergenic
1153350913 18:4080526-4080548 GAATCTGCATTGATGCAGCCAGG + Intronic
1153832755 18:8937654-8937676 AAATCTGCATTTATGCAGCCAGG + Intergenic
1155345029 18:24849296-24849318 AAAGCTGCAGGGATGCAGCTAGG + Intergenic
1155962646 18:32007679-32007701 AAAACAGCTGAGTTGAAGCCAGG - Intergenic
1156176353 18:34551618-34551640 AAAGCTGGAGAGATGAAGACAGG - Intronic
1156182911 18:34626768-34626790 GAAGCTACACAGATGCAGCCTGG + Intronic
1156242208 18:35265476-35265498 AGTACTGTAGAGTTGCAGCCTGG - Intronic
1156980813 18:43286333-43286355 CAAACTGCAAGGTTGCAGCCAGG + Intergenic
1157576775 18:48748948-48748970 AGAGATGCAGAGATGCAGCCTGG - Intronic
1158022496 18:52859661-52859683 AAACCTGCATTGATGGAGCCAGG - Intronic
1158386635 18:57000649-57000671 AAAACTGCAGTGATGCACACAGG + Intronic
1158869013 18:61666183-61666205 TAAACTGCAGAAATTGAGCCAGG + Intergenic
1158870128 18:61678409-61678431 AAATCTGCATTGATGCAGCCAGG - Intergenic
1160044874 18:75377172-75377194 TTAAATGCAGAGAAGCAGCCAGG - Intergenic
1161385151 19:3987712-3987734 ATAACTGCAGGGATGGAGCCAGG + Intergenic
1161722542 19:5911273-5911295 AAAAATGCAAAAACGCAGCCAGG - Intronic
1161922554 19:7277500-7277522 AGAACTGCAGAGATGTTGGCCGG + Intronic
1163470029 19:17490866-17490888 AAAAATACAGAAATGTAGCCTGG + Intronic
1164090763 19:21949787-21949809 AAAACTGCTCAGAGGCAGGCTGG - Intronic
1164348697 19:27303315-27303337 AAAACTACACAGATGCATTCTGG + Intergenic
1164348707 19:27303485-27303507 AAAACTACACAGATGCATTCTGG + Intergenic
1164558828 19:29274520-29274542 AGAATGGCAGAGATACAGCCAGG + Intergenic
1165279895 19:34786831-34786853 AGAACTGAAGAGATGCACCTAGG - Intergenic
1165705124 19:37970474-37970496 CAAACTGCAGAGATTCAGAACGG - Intronic
1166459315 19:42972323-42972345 AATTCTGCACGGATGCAGCCAGG + Intronic
1167674519 19:50876038-50876060 GAAACAGCAGAGAGGAAGCCAGG - Intronic
925435097 2:3830202-3830224 GAAACTGCAGAGATGCATTTAGG - Intronic
926234487 2:11028933-11028955 AAAACTGGATCCATGCAGCCAGG + Intergenic
927720763 2:25380633-25380655 AAGACAGAAGAGATGCAGACAGG + Intronic
928450559 2:31374715-31374737 ACAACTGCAGAGATGGAGTGTGG - Intronic
929050858 2:37835444-37835466 AAAAATGAAGAGAAGCGGCCGGG - Intergenic
929269118 2:39953567-39953589 AACATTGTAGAGAGGCAGCCAGG + Intergenic
929753346 2:44740423-44740445 AAAATTGCAGCAATCCAGCCGGG - Intronic
930105567 2:47636405-47636427 AACAATGCAGAGATTCACCCAGG - Intergenic
930722015 2:54646999-54647021 AAAACTCCAGAGGTGCAGTACGG - Intronic
931864756 2:66397455-66397477 AACACTGAAGAGATGGATCCAGG + Intergenic
932092205 2:68816373-68816395 AAAACTGCAGAGTTGATACCAGG - Intronic
933369174 2:81393558-81393580 GAATCTGCATAGATGAAGCCAGG - Intergenic
936473376 2:112818590-112818612 AAAAATGCAGGGATCCAGCCTGG + Intergenic
936667256 2:114610738-114610760 AAAACTACAGAGACTGAGCCCGG - Intronic
937132976 2:119527080-119527102 AACTCTGCACTGATGCAGCCAGG + Intergenic
937504337 2:122519728-122519750 AATACTTCAGAGTTGAAGCCAGG + Intergenic
937677782 2:124610663-124610685 AAAAATCCAGCTATGCAGCCAGG + Intronic
938137525 2:128771210-128771232 GAATCTGCATCGATGCAGCCAGG + Intergenic
938197895 2:129347498-129347520 AAATTTGCAGAGAGGCACCCTGG + Intergenic
940475265 2:154153654-154153676 CAAACTGCAAAGTGGCAGCCAGG - Intronic
941540255 2:166773316-166773338 AAATCTGCATTGGTGCAGCCAGG + Intergenic
941594231 2:167455806-167455828 AATAATGGAGAGATCCAGCCAGG - Intergenic
942051888 2:172147739-172147761 GAATCTGCATTGATGCAGCCAGG - Intergenic
943952140 2:194144647-194144669 AAATCTACATTGATGCAGCCAGG + Intergenic
944538846 2:200737862-200737884 AAATCTGCAGAGATCCAGGCTGG + Intergenic
945735722 2:213597873-213597895 AAATCTGCCTTGATGCAGCCAGG + Intronic
946747527 2:222861055-222861077 ACAACTGCAGTGTCGCAGCCCGG - Exonic
946804098 2:223452379-223452401 AAATCTGAAATGATGCAGCCTGG - Intergenic
946981802 2:225225958-225225980 AAAACTACAGAGATGGAGAAAGG + Intergenic
948879105 2:240847061-240847083 AAACCTGCATTGATGCAGCCAGG - Intergenic
1169390032 20:5182960-5182982 AAAACTGCTGAGAAGCAGGTAGG - Intronic
1170016624 20:11789151-11789173 AAATCTGCATTGATGCAGCATGG - Intergenic
1171213507 20:23335045-23335067 AAACCTGCAGAGTTGAAGCAAGG - Intergenic
1172080064 20:32333335-32333357 AAAACTGCAGATAACCGGCCGGG + Exonic
1173639392 20:44589826-44589848 AAATCTGAAGAGATGCAAGCAGG + Exonic
1173921071 20:46745535-46745557 GAAACAGCAGAGATGAAGCAGGG + Intergenic
1174647890 20:52101821-52101843 AAAAATGCAGAGTCTCAGCCGGG + Intronic
1175204363 20:57300541-57300563 AAAGCTGCAGAGGTACAGTCGGG - Intergenic
1175212453 20:57369459-57369481 AAATCGGCATTGATGCAGCCAGG - Intronic
1175626179 20:60489808-60489830 GCAACTGCAGAGATGCTTCCGGG - Intergenic
1175970799 20:62685814-62685836 AAACCTGCAGAGCTGCTTCCCGG + Intergenic
1178503967 21:33148340-33148362 AAAACTGGAGCGATTCAGGCTGG + Intergenic
1178530347 21:33370777-33370799 AAATCTGCACGGATGCAACCAGG + Intergenic
1180867601 22:19128352-19128374 AAGAAGGCAGATATGCAGCCAGG + Intergenic
1180949166 22:19713569-19713591 AAGCCTTCAGAGATGCCGCCTGG + Intergenic
1181772311 22:25134695-25134717 AAAGCTGCAGAGCGGCAGCATGG - Intronic
1183407343 22:37636857-37636879 AAATCTGCACAGAGGCTGCCAGG + Intronic
1183644397 22:39115274-39115296 AAATCTGCATTGCTGCAGCCTGG - Intergenic
1184039826 22:41936207-41936229 AAAACTGGAGAGAAGCAGAGTGG + Intergenic
951629784 3:24707183-24707205 AAAACTGCAGAACTGAAGCTAGG - Intergenic
951730760 3:25808075-25808097 ACAACAGCAGTGATGCAGACAGG - Intergenic
952226158 3:31378502-31378524 AATACAGAAGAGATGCAGCAAGG - Intergenic
952661656 3:35857524-35857546 AAAAGTTCAGAGAAGTAGCCAGG - Intergenic
952720880 3:36531484-36531506 ACAAATGGAGAGATGCAGACAGG + Intronic
953039331 3:39241003-39241025 AAATCTGCAGAGAGGCTGGCAGG - Intergenic
953291433 3:41667766-41667788 AAAGCAGCAGAGATCCAGGCAGG + Intronic
954123521 3:48514945-48514967 AAAACAGCACAGATTCATCCTGG + Intergenic
954695431 3:52422212-52422234 CCCACTGCAGAGATGCTGCCTGG + Exonic
954782757 3:53073169-53073191 AACACTGCAGAGAGAGAGCCTGG + Intronic
954856763 3:53650528-53650550 CAAAATGCAGTCATGCAGCCTGG + Intronic
955025969 3:55167819-55167841 CAAACTGCAGAGCTGCAGCTGGG + Intergenic
955171334 3:56568133-56568155 AAATCTGCAATGACGCAGCCAGG - Intronic
955310777 3:57884646-57884668 AAAAATGCAAAGAATCAGCCGGG + Intronic
956664174 3:71626751-71626773 AAAGCTGGAGAGAAGCAGGCAGG - Intergenic
957419355 3:79949275-79949297 AAAAATGCAGAAAAGCAACCAGG + Intergenic
957818905 3:85343758-85343780 AAAGCTTCAGAGAGGAAGCCAGG + Intronic
958553552 3:95645441-95645463 AAAACTGCAAAGCAGCAGCGTGG + Intergenic
958717584 3:97804189-97804211 AAATCTGCACTGATGCAGCCAGG + Intergenic
959822415 3:110752284-110752306 AAATCTTCATTGATGCAGCCAGG + Intergenic
960378101 3:116928002-116928024 AAAACTCTAGAGAGGCAGTCTGG + Intronic
962655958 3:137543980-137544002 AGACCTGCAGGGGTGCAGCCTGG + Intergenic
962975691 3:140443922-140443944 AAGACTGCAGAAATCCAGGCTGG - Intronic
964217208 3:154299110-154299132 AAAAATGCAGAAAGTCAGCCGGG + Intronic
965141922 3:164849008-164849030 AAATCTGCATTTATGCAGCCAGG - Intergenic
968044785 3:195617984-195618006 AGAACTGCAGGGTTGGAGCCTGG - Intergenic
968060570 3:195724036-195724058 AGAACTGCAGGGTTGGAGCCTGG - Intronic
968520634 4:1033299-1033321 ACAGCTGCTGAGATGCAGCTGGG - Intergenic
969637571 4:8378213-8378235 CAGACTGCAGCCATGCAGCCTGG + Intronic
970024288 4:11605417-11605439 ATAAGTGCAGAGAAGAAGCCAGG + Intergenic
970051640 4:11921160-11921182 AAAAAGGCAAAGATGCAGACCGG + Intergenic
970493995 4:16607302-16607324 AAAACAGAAGAGATGAAGCAAGG - Intronic
971263156 4:25075409-25075431 AGCTCTGCAGAGACGCAGCCGGG - Intergenic
971917588 4:32893196-32893218 AAAAGTGGTAAGATGCAGCCGGG + Intergenic
973866172 4:55116119-55116141 AAAACTGAAGAGATTCTGACTGG + Intronic
974203273 4:58668320-58668342 AAATCTGCATTGATGCAGTCAGG + Intergenic
974672174 4:65046531-65046553 CACACAGCAGAGCTGCAGCCAGG - Intergenic
976399150 4:84587962-84587984 AAATCTGCATTGATGCAACCTGG - Intronic
976659419 4:87524000-87524022 AAAATTCCAGAAATGCAGCAAGG - Intronic
976740585 4:88352515-88352537 AAATCTGCATTGATGAAGCCAGG - Intergenic
976744367 4:88388830-88388852 AAATCTGCATTGATGCAGGCAGG - Intronic
976959450 4:90950688-90950710 AAAACAGCAGGGTTTCAGCCTGG + Intronic
977048379 4:92095191-92095213 AATACTGAAGAGAACCAGCCAGG - Intergenic
977825330 4:101524410-101524432 AAATCTGCACAGATGCATCCAGG - Intronic
978284761 4:107063170-107063192 AAAACTTTAGAGATGGGGCCAGG + Intronic
978533945 4:109741263-109741285 AGAGTTGCAGAGATGCAGCTTGG + Intronic
978542752 4:109836529-109836551 AAGACAGCAGGGAGGCAGCCTGG - Intronic
978840775 4:113209368-113209390 GAATCTGCATTGATGCAGCCAGG - Intronic
979358246 4:119730983-119731005 AAATCTGCACTGATGCAACCAGG - Intergenic
981561670 4:146055069-146055091 AAAACTACTGGGATGCAGGCAGG - Intergenic
981772250 4:148323477-148323499 CAAACTGCAAGGCTGCAGCCAGG - Intronic
981941294 4:150284128-150284150 GACACTGTAGATATGCAGCCAGG + Intronic
982089282 4:151866580-151866602 TCAAATGCAGAGCTGCAGCCTGG + Intergenic
984141262 4:176006057-176006079 AAACCTGCATTGATGCAGCCAGG - Intergenic
986111285 5:4721067-4721089 AGAATTGCAGACATGCAGGCAGG - Intergenic
986509457 5:8488690-8488712 GAATCTGCAGTGATGCAGCCAGG - Intergenic
986731486 5:10637812-10637834 AAAACAGCAGCGCTGCAGCCAGG + Intronic
986874517 5:12091884-12091906 GAGAGTGGAGAGATGCAGCCAGG + Intergenic
987077425 5:14397174-14397196 GAAACTGCATAGATGCACACTGG - Intronic
987200895 5:15577080-15577102 AAATCTTCTGAGAAGCAGCCTGG + Intronic
987467623 5:18291223-18291245 AAAAATCCAGAGCTCCAGCCAGG + Intergenic
989181070 5:38577573-38577595 AAAACTGGAGAGAAGCACTCTGG - Intronic
989638847 5:43564002-43564024 AAATCTGTATTGATGCAGCCAGG - Intergenic
990514382 5:56518174-56518196 AACACTGAAGGGAAGCAGCCAGG - Intronic
990546342 5:56825550-56825572 AGCAGGGCAGAGATGCAGCCTGG - Intronic
990582244 5:57175641-57175663 AATACTGAAGAAATGCTGCCTGG - Intronic
990826377 5:59903803-59903825 GACACTGCAGAGAGGCAGGCAGG - Intronic
991535607 5:67666550-67666572 CAAACTGCAAAGCGGCAGCCAGG - Intergenic
992524808 5:77598439-77598461 AAACCTGAAAAGATGCAGACAGG + Intronic
996505659 5:124265354-124265376 AAATCTGCATTGATGTAGCCGGG + Intergenic
997230162 5:132236576-132236598 AAAAATAGAGAGAGGCAGCCTGG - Intronic
998672910 5:144373953-144373975 GAAACTGCAGTGATGCAGCTAGG - Intronic
999820505 5:155223151-155223173 AAAACTGTAGAGATTCAGCAAGG - Intergenic
999894229 5:156011775-156011797 AAAAGTGCAGAGAAGAATCCAGG - Intronic
1000749644 5:165078056-165078078 AAAACAGCAGAAATGTAGCAGGG - Intergenic
1002784438 6:391368-391390 TAAACTGCAGCGATGTGGCCAGG - Intergenic
1005515145 6:26547529-26547551 AAAAATGCAGAGACACGGCCGGG - Intergenic
1005704314 6:28436223-28436245 CAGACTGCAGAGATGCAGGAAGG - Exonic
1006245192 6:32727619-32727641 ACAACTGCAGAGAGGCCGCAAGG - Intergenic
1007554966 6:42758126-42758148 AAACCTGAAGAGAGGGAGCCAGG - Intronic
1007687693 6:43676789-43676811 AAATCTGCAGTTATGCAGCAAGG - Intronic
1008463138 6:51799297-51799319 AAAAATGGAGAGATGAATCCAGG - Intronic
1008698654 6:54072389-54072411 AAGACAGCAGAAATGCAGCAGGG - Intronic
1009376771 6:62980851-62980873 AAAGCTGGAGAAATGCAGCTGGG + Intergenic
1009934882 6:70222382-70222404 AGAAGTGCAGACATGGAGCCAGG - Intronic
1012848754 6:104422706-104422728 AAGACTGTAGAGATGAAGCATGG + Intergenic
1014833208 6:126127087-126127109 AACACTGCAGAGAAGGAGACCGG - Intergenic
1019021076 6:168918242-168918264 ACCACTGTAGAGATGCAGGCAGG + Intergenic
1019165582 6:170095658-170095680 ACAACTGCAGAGGTGCTGGCAGG - Intergenic
1019213417 6:170424177-170424199 ACAGCTGCAGACATTCAGCCAGG - Intergenic
1020344167 7:7145344-7145366 GAAACTGCAAGGAGGCAGCCTGG - Intergenic
1021035947 7:15799149-15799171 AAAACTGAAAAGATGCAACAAGG + Intergenic
1022290898 7:29001602-29001624 AAAACAGCAGAGATCAAGGCTGG + Intronic
1022684080 7:32578326-32578348 AAATCTGCATTAATGCAGCCTGG - Intronic
1023260451 7:38353455-38353477 TAAACCTCAGAGAAGCAGCCTGG - Intergenic
1024045259 7:45581352-45581374 AAAACTGAACAGCTGCAGCGAGG + Intronic
1024696815 7:51866459-51866481 AAAACTGCAAAACTGGAGCCTGG - Intergenic
1026009433 7:66625362-66625384 AAAACTACAAAAATGTAGCCAGG + Intergenic
1027231935 7:76277787-76277809 CAAACTCCAGAGTTGGAGCCAGG + Intronic
1027423469 7:78039920-78039942 AAAACTGCAGAGATCCGCCTGGG - Intronic
1027989221 7:85335315-85335337 CAAACTGCAAGGAAGCAGCCAGG - Intergenic
1028022209 7:85791302-85791324 CAAACTGCAAAGCAGCAGCCTGG + Intergenic
1028756767 7:94444572-94444594 AAAGATGCAGAGATGCATTCAGG + Intergenic
1029092446 7:98058601-98058623 AAAACAGTAGAAATGCGGCCAGG + Intergenic
1030116109 7:106063477-106063499 GAATCTGCATTGATGCAGCCAGG - Intergenic
1032820186 7:135517378-135517400 ACTACTGCAGAAGTGCAGCCTGG + Intergenic
1033158577 7:138977575-138977597 AAAGATGCAGAAATCCAGCCTGG + Intronic
1033767299 7:144507532-144507554 AAAACTGCCGAGATAAAGCCCGG - Intronic
1034076433 7:148235978-148236000 AAAGCTGCACAGCTGTAGCCAGG - Intronic
1034164538 7:149015180-149015202 AAAACTGCAGAGATGCAGCCAGG - Intronic
1034339575 7:150343039-150343061 AAATCTGCATTGATGTAGCCAGG + Intergenic
1034424617 7:151007918-151007940 AAATCTGCTGAGCTCCAGCCTGG - Intronic
1034987677 7:155527276-155527298 AAACCTGCATAGCTGCTGCCTGG + Intronic
1035547358 8:493477-493499 AGAAGTGCAGAGAAGCAGACCGG + Intronic
1035882247 8:3255586-3255608 CAAACTGCAGGGCTGCAGCAAGG - Intronic
1035996337 8:4551543-4551565 GAACCTGCAGAGAGTCAGCCAGG - Intronic
1036918701 8:12831297-12831319 AAAACATCAGTGATTCAGCCTGG - Intergenic
1037344221 8:17881050-17881072 AAAACTGCATACATGCAACAAGG + Intronic
1039697615 8:39929330-39929352 CAAAGTGCTGGGATGCAGCCAGG + Intergenic
1040534667 8:48298045-48298067 AAAGGTGCAGAGAAGAAGCCAGG - Intergenic
1041103646 8:54420679-54420701 AAAACTCCTGTGCTGCAGCCTGG + Intergenic
1041759347 8:61347199-61347221 AAAACTGCTGAGATGCTCCTTGG - Intronic
1041804852 8:61838855-61838877 AGATCTGCATTGATGCAGCCTGG - Intergenic
1043074038 8:75673508-75673530 AAAGCTGCAGAGAGTGAGCCAGG - Intergenic
1043192856 8:77248680-77248702 AAATCTGCATTGATGCAACCAGG - Intergenic
1044808123 8:96029722-96029744 CAAACTGAATAGATGCAGCAGGG - Intergenic
1044867890 8:96590306-96590328 ACAAGTCCAGAGCTGCAGCCTGG - Intronic
1045979232 8:108165045-108165067 AAATCTACAGAGAGGCAGCATGG - Intergenic
1047857696 8:128930309-128930331 TAAACTGAAGAGTTGCAGTCAGG - Intergenic
1048054254 8:130848350-130848372 CAGGCTGCAGAGAAGCAGCCAGG - Intronic
1048378165 8:133840780-133840802 AAACCTGCACAGAGACAGCCAGG - Intergenic
1049652934 8:143783294-143783316 AAAACTGCAGTGAGGCACCACGG - Intergenic
1051629737 9:19130286-19130308 AAATCTGCATTGATGCAGCCAGG + Intronic
1051702864 9:19843107-19843129 AAAAATAAAGATATGCAGCCAGG + Intergenic
1052252887 9:26420902-26420924 AAAACTGCAGGTATCCTGCCAGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053435952 9:38074593-38074615 AGAACAGCAAAGAGGCAGCCTGG - Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1055930389 9:81554171-81554193 TAAACAGCAGAGATTCAGTCAGG + Intergenic
1056213364 9:84385808-84385830 AAATCTGCATGGAGGCAGCCAGG + Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056792992 9:89638180-89638202 AGTCCTGCAGAGATGCAGTCTGG - Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057761193 9:97875834-97875856 AAAACTCCAGAGATCCACTCTGG + Intergenic
1058052461 9:100420716-100420738 AAATCTGCAAAGAGGCAGACTGG + Intergenic
1058200174 9:102028764-102028786 AAAACAGCAGAGATGGTGACCGG + Intergenic
1059329906 9:113528368-113528390 GCAAGTGCAGAGAAGCAGCCTGG - Intronic
1061294851 9:129671499-129671521 AAAACTCCAGAAAAGCAGCTTGG + Intronic
1061418978 9:130463155-130463177 AAAACTGCATGGGCGCAGCCAGG - Intronic
1061945512 9:133906476-133906498 AAGGCTGCAGAGAGCCAGCCAGG + Intronic
1062548477 9:137074743-137074765 AAGAATGCAGAAAGGCAGCCTGG + Intergenic
1185589670 X:1266321-1266343 AAGACGGTAGAGGTGCAGCCTGG + Intergenic
1185689200 X:2139384-2139406 AAAACTTCAGAAATCCAGGCAGG + Intergenic
1185731853 X:2467997-2468019 AAAGGTGCACAAATGCAGCCAGG + Intronic
1185732627 X:2473650-2473672 AAAGGTGCACAGAGGCAGCCAGG + Intronic
1185733225 X:2477872-2477894 AAAGGTGCACAGAGGCAGCCAGG + Intronic
1186200564 X:7151716-7151738 AACACTGCAGAGAAGCAAACTGG - Intergenic
1186259227 X:7758147-7758169 AAAAATCCAGACATGTAGCCTGG - Intergenic
1186725695 X:12356160-12356182 AAATCTGCACTGATGCACCCAGG - Intronic
1186830295 X:13383469-13383491 AAATCTGCACTGATGCAGCCAGG - Intergenic
1187112866 X:16319511-16319533 AAATCTGCATTGATGCAGGCAGG + Intergenic
1187842718 X:23505601-23505623 AAATCTGCATGGATGCAGCCAGG + Intergenic
1188221240 X:27543995-27544017 AAATCTGCATTGATACAGCCAGG + Intergenic
1188289256 X:28367801-28367823 CAAACTGCAAAGCTGCAGCGAGG - Intergenic
1189195171 X:39146740-39146762 AAAAATTTGGAGATGCAGCCTGG + Intergenic
1189683815 X:43543262-43543284 AAATCTGCATTGATGCAGCTAGG + Intergenic
1190026410 X:46927688-46927710 AAAACTGGGGAGATTAAGCCAGG - Intronic
1191569166 X:62586211-62586233 AAAACTGCACAGAAGCATTCTGG + Intergenic
1192139645 X:68636838-68636860 AGACCTGGAGTGATGCAGCCTGG + Intergenic
1192160414 X:68782218-68782240 GAATCTGCACTGATGCAGCCAGG - Intergenic
1192161433 X:68791131-68791153 GAATCTGCACTGATGCAGCCAGG + Intergenic
1192231493 X:69268170-69268192 GAATCTGCATTGATGCAGCCAGG - Intergenic
1192239305 X:69316742-69316764 GAATCTGCATTGATGCAGCCAGG + Intergenic
1192554816 X:72081062-72081084 AAAACTCCAGAGACACAGCATGG - Intergenic
1192790974 X:74381584-74381606 GAATCTGCATTGATGCAGCCAGG + Intergenic
1193015282 X:76725629-76725651 CAAACTGCAGGGCGGCAGCCAGG - Intergenic
1195758349 X:108221104-108221126 AAAAATGCAGAAATGCAGCCTGG + Intronic
1196222227 X:113124936-113124958 GAATCTGCATAGATACAGCCAGG - Intergenic
1196257683 X:113541112-113541134 AAATCTGTAATGATGCAGCCAGG + Intergenic
1196432732 X:115644299-115644321 AAAAATTAAGAAATGCAGCCAGG + Intronic
1196917920 X:120557999-120558021 AAAACTACACAGATGAAACCTGG - Exonic
1201899576 Y:19035033-19035055 CAAACTGCAAGGCTGCAGCCAGG + Intergenic