ID: 1034165255

View in Genome Browser
Species Human (GRCh38)
Location 7:149020569-149020591
Sequence GCCTGAGCAACAGCCTTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 153}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034165248_1034165255 11 Left 1034165248 7:149020535-149020557 CCACACAGGCCAACAGCCTGCAC 0: 1
1: 0
2: 0
3: 21
4: 261
Right 1034165255 7:149020569-149020591 GCCTGAGCAACAGCCTTTGAGGG 0: 1
1: 0
2: 0
3: 13
4: 153
1034165252_1034165255 2 Left 1034165252 7:149020544-149020566 CCAACAGCCTGCACTTGGGGCAG 0: 1
1: 0
2: 1
3: 22
4: 252
Right 1034165255 7:149020569-149020591 GCCTGAGCAACAGCCTTTGAGGG 0: 1
1: 0
2: 0
3: 13
4: 153
1034165247_1034165255 14 Left 1034165247 7:149020532-149020554 CCACCACACAGGCCAACAGCCTG 0: 1
1: 0
2: 1
3: 20
4: 308
Right 1034165255 7:149020569-149020591 GCCTGAGCAACAGCCTTTGAGGG 0: 1
1: 0
2: 0
3: 13
4: 153
1034165253_1034165255 -5 Left 1034165253 7:149020551-149020573 CCTGCACTTGGGGCAGCTGCCTG 0: 1
1: 0
2: 7
3: 62
4: 464
Right 1034165255 7:149020569-149020591 GCCTGAGCAACAGCCTTTGAGGG 0: 1
1: 0
2: 0
3: 13
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034165255 Original CRISPR GCCTGAGCAACAGCCTTTGA GGG Intronic
914950675 1:152110855-152110877 GCCTGGCCGACAGCCTCTGACGG + Exonic
915252824 1:154602703-154602725 GCCTGTGGAACAGCCCTTGAAGG + Intronic
915500242 1:156311023-156311045 GCCTGGGCAACAGCCCTGTATGG + Exonic
915731347 1:158056459-158056481 TCATGAGCATCAGCCTTTGGGGG - Intronic
916317451 1:163465733-163465755 GCCTCAGCAACAGCATTAAATGG - Intergenic
917526565 1:175793376-175793398 GCCTGATCAATGGCCTTTGGGGG + Intergenic
920582020 1:207118946-207118968 GCCACAGCAACAGACATTGAAGG - Intronic
922805706 1:228387726-228387748 GCCTGGGCCAGAACCTTTGATGG - Intergenic
922856311 1:228777858-228777880 GCCTGGGGAACAGCCTGTGCAGG + Intergenic
923419246 1:233796426-233796448 GCAGCAGCAGCAGCCTTTGAAGG - Intergenic
1069579374 10:69554874-69554896 GCCTGAGCAGGAACCCTTGAGGG + Intergenic
1071437587 10:85661676-85661698 ACCTGAGCTAGTGCCTTTGAAGG - Intronic
1071599413 10:86950403-86950425 GCCTGAGCACCAGCATTTTAAGG + Intronic
1074180694 10:111060160-111060182 ACCTGAGAAACAGCCCTGGAGGG + Intergenic
1076484094 10:130804770-130804792 GACTTACCAAGAGCCTTTGATGG - Intergenic
1077420293 11:2446788-2446810 GCCTGAGCCACAGCCGCTGCTGG + Intronic
1078351930 11:10601997-10602019 GCCTGAGCTAGATCCTCTGAGGG - Intronic
1078963559 11:16308918-16308940 AGCTCAGCAAGAGCCTTTGATGG - Intronic
1082204988 11:49422336-49422358 GCCTGAGGAAAAGTCTTTGATGG + Intergenic
1082826983 11:57587159-57587181 GCCTGAGCTAAAGCCCTTCATGG - Intergenic
1086650104 11:89278206-89278228 GCCTGAGGAAAAGTCTTTGATGG - Intronic
1089970815 11:122691796-122691818 GCTTGAGCAAAAGGCTGTGATGG + Intronic
1090969063 11:131623959-131623981 GTCAGAGCAACTGCCTTTGTGGG - Intronic
1091896600 12:4110128-4110150 GCTTGACCAACAGCCTTTGGTGG + Intergenic
1093419248 12:18955942-18955964 GCCAGAGGAACAGCCTCAGAAGG + Intergenic
1094750138 12:33397043-33397065 GTCTTATCATCAGCCTTTGAAGG + Intronic
1096653298 12:53072959-53072981 CCCTGCACAACTGCCTTTGAGGG - Intronic
1097159637 12:57037302-57037324 GCCTGAGGCAGAGCCCTTGAGGG - Intronic
1097811905 12:64028152-64028174 AGCTAAGCAACAGCCTTTGGTGG - Intronic
1103443727 12:120980704-120980726 GCTTGATCCACAGCATTTGAAGG + Intronic
1104410298 12:128552051-128552073 GCCTCATCAACAGCCTTAGGGGG - Intronic
1105606766 13:21932490-21932512 GCCAGAGCAACTACCTTCGAGGG - Intergenic
1108499454 13:51056289-51056311 GCCTGAGAAAGAGGGTTTGATGG - Intergenic
1117493678 14:56277821-56277843 GCATGAGCAACTCCATTTGAGGG + Intronic
1119196233 14:72718686-72718708 ACCTGAATAACAGCCTTTGGGGG + Intronic
1120685462 14:87531901-87531923 GCCTGAGCTACAGGCTATGAAGG - Intergenic
1120919706 14:89743764-89743786 GACTGAGCAACTTCCTGTGATGG + Intergenic
1122923936 14:104891311-104891333 GCCTGCCCCACAGCCTTTCAGGG - Intronic
1123062815 14:105601901-105601923 GGCTGAGCAACAGCTTCTGGTGG - Intergenic
1124096232 15:26651056-26651078 GCCTGTGTAACAGCCTTTTTGGG - Intronic
1126026345 15:44449345-44449367 GCCTGGGCAACAGGCACTGAAGG - Intronic
1126326573 15:47484346-47484368 GCCTCACCAACAGCCATTTAGGG + Intronic
1126820991 15:52504023-52504045 ACAGCAGCAACAGCCTTTGAAGG - Intronic
1128965404 15:72052708-72052730 GCCTGATCCACAGCCTTGCAAGG + Intronic
1133759448 16:8786549-8786571 GCCTGGCCATCAGCCTTGGAAGG - Intronic
1134882695 16:17759367-17759389 GCCTGGGCAATAGCCATTGTTGG + Intergenic
1135549415 16:23386735-23386757 GACTGAGAAACAGCCAGTGAGGG + Intergenic
1136712225 16:32248504-32248526 GCCTGGGCAACAGAATGTGAGGG - Intergenic
1136755689 16:32680900-32680922 GCCTGGGCAACAGAATGTGAGGG + Intergenic
1136812424 16:33189472-33189494 GCCTGGGCAACAGAATGTGAGGG - Intergenic
1136818900 16:33299552-33299574 GCCTGGGCAACAGAATGTGAGGG - Intronic
1136825463 16:33356085-33356107 GCCTGGGCAACAGAATGTGAGGG - Intergenic
1136830529 16:33454856-33454878 GCCTGGGCAACAGAATGTGAGGG - Intergenic
1202991001 16_KI270728v1_random:12442-12464 GCCTGGGCAACAGAATGTGAGGG - Intergenic
1203057832 16_KI270728v1_random:941256-941278 GCCTGGGCAACAGAATGTGAGGG + Intergenic
1144038812 17:11390431-11390453 GTCTGTGCATCATCCTTTGAGGG - Intronic
1144234160 17:13240804-13240826 GACTGTGCAACTGCCTATGAGGG - Intergenic
1147188861 17:38727324-38727346 GCCTAAGAAATTGCCTTTGAAGG - Exonic
1148895256 17:50835801-50835823 GCCTGAGCAGCAGCCTGAGCAGG + Exonic
1149688352 17:58552338-58552360 GCCTGGGCAACAGAGCTTGATGG - Intergenic
1151761549 17:76106261-76106283 GCCTGAGCCTCACCCTTTGCTGG - Intronic
1155505404 18:26528232-26528254 GAATGAGGAACAGCCTTTAATGG + Intronic
1156640183 18:39085670-39085692 GCGTGAGCCACCGCCTTTGGTGG + Intergenic
1158904792 18:62001390-62001412 GCTTGAGCCACAGCTCTTGAGGG - Intergenic
1162743658 19:12787139-12787161 GCCTGAGCAACAGAGTGAGATGG + Intronic
1165045383 19:33100743-33100765 GCCTGTGAAAGAGCTTTTGATGG + Intronic
1165400158 19:35594178-35594200 GCGTGAGCCACAGCCCTGGACGG + Intergenic
926210868 2:10868605-10868627 GCCTGTGCCACAGCCTTGCAGGG - Intergenic
927837118 2:26408020-26408042 GACTGAGAAGCAGGCTTTGAAGG - Intronic
928996997 2:37303338-37303360 GCCTATGCAACAGCCTTTTTTGG - Intronic
931877368 2:66528557-66528579 GGATGAGCAACTGCCTGTGAAGG - Intronic
932455487 2:71846928-71846950 GCCTGAGCATCTTCCTCTGAGGG - Intergenic
934140629 2:89043923-89043945 GCCTGTGACACAGCCTTAGAAGG - Intergenic
934976185 2:98804201-98804223 GACTGAGCAAGAGCTTTTCAGGG + Intronic
935391130 2:102553814-102553836 GCAGCAGCCACAGCCTTTGAAGG + Intergenic
937600919 2:123731011-123731033 GCCTCAGCAACTGCCTCTGAGGG - Intergenic
939814326 2:146875087-146875109 TCATGAACAACAGCCTTTGATGG + Intergenic
942091696 2:172497993-172498015 TACTGAGCTACAGTCTTTGAGGG - Exonic
942691888 2:178594157-178594179 GCCTGAGTAACGGCCAGTGAGGG + Exonic
943309321 2:186307232-186307254 GCCTGCGCCACAGCCTCAGAAGG - Intergenic
943851759 2:192732281-192732303 GCTTGAGTAACAGCCTTTCAAGG - Intergenic
946716848 2:222561949-222561971 GCCTGAACCATACCCTTTGAAGG - Intergenic
947897749 2:233691414-233691436 GCCTGAGCAACATGATTAGAGGG - Intronic
948524279 2:238560583-238560605 TCCTGAGCTCCAGCCTTCGAGGG + Intergenic
1171183946 20:23111579-23111601 GCCTGAGCAGCAGCCCGTGCAGG - Intergenic
1172807194 20:37620744-37620766 GGGAGAGCAACAGGCTTTGAGGG + Intergenic
1173205784 20:40991961-40991983 GCCTGAGACACAGACTTGGATGG + Intergenic
1173410215 20:42803393-42803415 GCCTGAGCCTCAGCCTATCAGGG + Intronic
1175424057 20:58853340-58853362 GCCCGAGCAACCACCTTTGGAGG + Exonic
1175782708 20:61693659-61693681 TCCTGAGCTACAGCGTTAGAGGG + Intronic
1178540905 21:33448822-33448844 GCCTGAGCTCCAGCATTTGAAGG + Intronic
1179180445 21:39040295-39040317 AACTGAGACACAGCCTTTGAGGG - Intergenic
1179454882 21:41492409-41492431 GCTTTAGCAACAGCCGTAGAAGG - Intronic
1179630172 21:42672970-42672992 GCTTGCGAAACAGCCTTTGAAGG + Intronic
1181035317 22:20167142-20167164 GCCTGTGCAACAGGCATAGAAGG + Intergenic
1182787702 22:32921360-32921382 ACCTGAGCAACAGATTTTTAAGG + Intronic
1185132577 22:49047642-49047664 CCCTGTGTAACAGCCTTTGGAGG + Intergenic
952127457 3:30318393-30318415 GCCTCAGCATTGGCCTTTGAAGG - Intergenic
952437921 3:33290954-33290976 GCCTGAGCAACAGAGTGAGAGGG - Intronic
953464200 3:43105380-43105402 GCCTCCCCAACTGCCTTTGAAGG - Intronic
954329846 3:49884065-49884087 GCCTCAGCCCCAGCCTTTCAGGG - Intergenic
955405797 3:58624962-58624984 GCCTGATCAACAGCCTTCTGTGG + Intronic
955473379 3:59310557-59310579 CCATAACCAACAGCCTTTGATGG - Intergenic
956764370 3:72472054-72472076 GACTGAGCAAATGCATTTGATGG + Intergenic
959857454 3:111175751-111175773 GCTTCAGTAACAGCCTCTGATGG + Intronic
960476289 3:118133092-118133114 GCATCAGTAACAGGCTTTGAAGG + Intergenic
961207106 3:125093266-125093288 TCCTGAGCAACAAACTATGAAGG - Intronic
961344727 3:126256589-126256611 TCCTCAGCCAGAGCCTTTGAAGG - Intergenic
961353818 3:126321407-126321429 GCAGGAGCCACAGCCTTTGCAGG - Intergenic
961552392 3:127676808-127676830 GCCTGTAGAACAGCTTTTGATGG + Intronic
964051164 3:152395641-152395663 GCCTCAGCAAGAGCATTGGATGG + Intronic
968116527 3:196094691-196094713 GCCTGAGCAACATGCTACGAAGG + Intergenic
969109150 4:4830927-4830949 GCCTGGCCAACAGACTTTTATGG + Intergenic
970160254 4:13181109-13181131 GTCTGAGCAGCAGGCTTTCAAGG - Intergenic
971508263 4:27390406-27390428 GCCTAAGCAACAGTTTTAGACGG - Intergenic
979037410 4:115740940-115740962 GTCTGAGCAACAGCTTCTGTAGG - Intergenic
980507714 4:133744128-133744150 GCCTGAGCAACAGAGTGAGATGG + Intergenic
984815348 4:183831068-183831090 GCCTGAGCAGCTGGCTTGGAGGG + Intergenic
985477526 5:86623-86645 TCCTTTGCAACAGCCTTTGTTGG + Intergenic
985552744 5:541667-541689 GCCTGAGGCAGAGGCTTTGAGGG + Intergenic
985642245 5:1069175-1069197 ACCTGTGCAACAGCCTGAGAAGG + Intronic
985756425 5:1721693-1721715 GCCTGTGCCACAGCCTTGCATGG + Intergenic
986010096 5:3706436-3706458 GCCTGAGAAATGGCCTTTAAAGG - Intergenic
991670035 5:69038237-69038259 GCCTGAGAGAGAGCATTTGAAGG + Intergenic
998113937 5:139522438-139522460 GCCTGAGCTACCTCCTTTGGAGG - Intergenic
999786133 5:154892347-154892369 GCCTGAGGCACACCCTTTAATGG - Intronic
999879376 5:155844397-155844419 GCCTTAGCAACACCCTCTGGCGG - Intergenic
1001533868 5:172484166-172484188 GCCAGGGCCACAGCCTCTGAAGG - Intergenic
1002951360 6:1815476-1815498 ACCTGCGCAACAGCCTTATATGG + Intronic
1003899871 6:10644551-10644573 GCCTGAGCAACAGAGTAAGAAGG - Intergenic
1007007922 6:38384948-38384970 GCTTCAGCCTCAGCCTTTGAAGG + Intronic
1007070063 6:39029831-39029853 CCCTGAGCAACAGGCTTAGCCGG - Intronic
1007664635 6:43507049-43507071 GACTGAGCAACAGCCTTGGGGGG - Exonic
1010308284 6:74350282-74350304 GCCTGAGACACAGCCTTAGGAGG - Intergenic
1010735882 6:79443249-79443271 GCCTGAGCCACAGCCTAGGCTGG + Intergenic
1011149165 6:84250040-84250062 GTCAGATCAACAGCCTTTTAAGG + Intergenic
1019176267 6:170160828-170160850 GCCTGAGCCACAGCCCCAGAGGG - Intergenic
1021101275 7:16587648-16587670 GCCTGACCAACAGCATGTGGAGG + Intergenic
1025155855 7:56605543-56605565 CCCCTAGCAACAGCCTTTGCCGG - Intergenic
1031973981 7:128082435-128082457 GCCTGGGAAACAGCATTAGAGGG - Intronic
1032540327 7:132697548-132697570 GCATGAGGAACAGCCTGGGATGG + Intronic
1034165255 7:149020569-149020591 GCCTGAGCAACAGCCTTTGAGGG + Intronic
1035116629 7:156530120-156530142 GCATCAGCCACTGCCTTTGAGGG + Intergenic
1035889654 8:3329608-3329630 GCCTGAGCTCCAACCTGTGAAGG - Intronic
1036966355 8:13302377-13302399 GCCTTTGAAACAGCCTTTTATGG - Intronic
1039307492 8:36278496-36278518 ACCATAGCAACAGCCTTTGTAGG - Intergenic
1039467470 8:37795062-37795084 GCCTGGGCCACCGCCTGTGAGGG + Intronic
1039751291 8:40481295-40481317 GCCTGTGAAACAGACTTTAATGG + Intergenic
1043470674 8:80559253-80559275 GGCTGACCACCAGCCTTTCACGG + Intergenic
1043578672 8:81687320-81687342 GCCTCAGAAGCAGCCTTAGAAGG + Intergenic
1043860408 8:85309965-85309987 CCCTGAGCAAATGCCTTTGTAGG - Intergenic
1045682037 8:104672118-104672140 GCCAGAGCAGAGGCCTTTGATGG - Intronic
1046026457 8:108730065-108730087 GCCTGAATAAAAGCCTTTGTGGG + Intronic
1052670812 9:31554558-31554580 ACCTGAGCAACAGTCTTTGCTGG + Intergenic
1055698207 9:78911964-78911986 ACATGGGCTACAGCCTTTGAGGG - Intergenic
1057548545 9:96035394-96035416 GGCTGAGCACCAGGCTTTCATGG - Intergenic
1058526091 9:105859112-105859134 ACCTGAGCCTCAGCCTGTGATGG + Intergenic
1059885300 9:118738727-118738749 GCCTGAGCAAAAGACTCTGGAGG - Intergenic
1061548491 9:131318447-131318469 GCCAGGGCACCAGCCTGTGAGGG - Intergenic
1185791458 X:2930637-2930659 ACCTAAGCAACCCCCTTTGAGGG - Intergenic
1188779630 X:34265535-34265557 CCCTGAGCACTAGCCTTTCAGGG + Intergenic
1191880177 X:65837731-65837753 GCCTGAGCAGATGCCTGTGAGGG + Intergenic
1193325260 X:80172677-80172699 GCCTGAGTTACAGCCAATGAGGG - Intergenic
1197388358 X:125827925-125827947 GCCTAATTAACAGCCATTGATGG + Intergenic
1198955870 X:142129688-142129710 GCCTCAGCAACATCTTTAGAAGG + Intergenic
1199466887 X:148148059-148148081 GACTGAGCATCTGCCTCTGAGGG - Intergenic
1201282207 Y:12351910-12351932 ACCTAAGCAACCCCCTTTGAGGG + Intergenic