ID: 1034165422

View in Genome Browser
Species Human (GRCh38)
Location 7:149021704-149021726
Sequence ATGTCCCAGGGGAAGTTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 205}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034165415_1034165422 3 Left 1034165415 7:149021678-149021700 CCACAGCTCTAGAATATAAAGTC 0: 1
1: 0
2: 2
3: 16
4: 210
Right 1034165422 7:149021704-149021726 ATGTCCCAGGGGAAGTTGGAGGG 0: 1
1: 0
2: 2
3: 17
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034165422 Original CRISPR ATGTCCCAGGGGAAGTTGGA GGG Intronic
901335038 1:8442017-8442039 AAGTCCCTGGGGAAGTAGAATGG + Intronic
903001823 1:20271826-20271848 ATGCCTCAAGGGAAGTTGCAGGG - Intergenic
905261894 1:36725330-36725352 GTGTGCCAGAAGAAGTTGGAAGG + Intergenic
905310180 1:37043574-37043596 CTGTCACAGGGGGAGTAGGAGGG + Intergenic
905794637 1:40808648-40808670 CTGTCCCTGTGGAAGCTGGAGGG + Intronic
906110468 1:43318893-43318915 AGGTCTCTGGGGAAGCTGGAGGG + Intronic
912633575 1:111270703-111270725 AGGACCCAGGGAAAGTTGGGTGG + Intergenic
913690995 1:121279679-121279701 ATTTCCCAGGGGAAGCTTCATGG + Intronic
914146544 1:145000284-145000306 ATTTCCCAGGGGAAGCTTCATGG - Intronic
914956767 1:152169648-152169670 CTGTCCCAGGAGAAGAGGGAAGG + Intergenic
920077504 1:203348002-203348024 ATGGCCGTGGGGAAGTTGGGTGG + Exonic
920478318 1:206298154-206298176 ATTTCCCAGGGGAAGCTTCATGG + Intronic
924615037 1:245605696-245605718 AGGTCCCAGGGGAAGCAGCAAGG + Intronic
1063999752 10:11653750-11653772 CTGTTCCAGGGGAAGTATGATGG - Intergenic
1064582733 10:16810552-16810574 AATTCCCAGGAGAAGTTGGGCGG - Intronic
1067320771 10:45218696-45218718 AATTCCCAGGAGAAGTTGGGTGG - Intergenic
1067456328 10:46421784-46421806 TAGTCCCTGGGGAAGCTGGAAGG - Intergenic
1067630871 10:47962855-47962877 TAGTCCCTGGGGAAGCTGGAAGG + Intergenic
1069643554 10:69973520-69973542 TGGTCTCAGGGGAAGATGGAGGG - Intergenic
1070574172 10:77664986-77665008 AAGACCCATTGGAAGTTGGAGGG - Intergenic
1072339143 10:94429664-94429686 ATAACAGAGGGGAAGTTGGATGG - Intronic
1075856962 10:125637946-125637968 ATCACCAAGGGGAAGTTGGAGGG - Intronic
1076370063 10:129946935-129946957 AGGCCCCAGGGAAAGGTGGAAGG - Intronic
1076371850 10:129960255-129960277 AAGTGCCCGGGGAGGTTGGAAGG - Intronic
1076581232 10:131513357-131513379 ACTTCCCAGGGGGAGCTGGAAGG - Intergenic
1076821705 10:132942850-132942872 AAGTTCCCGGGGAAGGTGGAGGG - Intergenic
1076840420 10:133042584-133042606 ATGTCACAGGAGACCTTGGAGGG - Intergenic
1076941471 10:133612858-133612880 ATGTCCAGGAGGAAGTTAGATGG + Intergenic
1078107745 11:8369387-8369409 AAGCCCCAGGGGCAGTGGGAGGG + Intergenic
1080429593 11:32185942-32185964 CTGGCCCAAGGGAAGTGGGAAGG - Intergenic
1086412855 11:86559468-86559490 ATGTCCTGGGGGAAATGGGAAGG - Intronic
1089074173 11:115724774-115724796 ATGGCCAAGGGGAAGATGGGAGG - Intergenic
1089164912 11:116468365-116468387 ATTTCCTGGGGGAAGCTGGATGG + Intergenic
1089399485 11:118156237-118156259 ATGCCCCAGGGGAAGTCGGATGG + Intergenic
1090898823 11:131006608-131006630 ATGTCCCTGGGGTAGGTGGATGG + Intergenic
1091934480 12:4424159-4424181 AGGTCGCAGAGGAGGTTGGAGGG - Intergenic
1092062388 12:5562000-5562022 ATGTCTGAGTGGAAGTTGCAGGG - Intronic
1095683545 12:45005995-45006017 ATGTCCCTGGGGGAGTAAGAAGG - Intergenic
1096006501 12:48177416-48177438 ATATCCCAAGGGAGGTTAGAGGG + Intronic
1096851683 12:54442975-54442997 ATAGCCCAGAGGAAGTTGCAGGG + Intergenic
1097050730 12:56221678-56221700 ATGTCCCAGGGGTATTGGGGCGG - Intronic
1097703616 12:62845655-62845677 ATCTCCCAGGGAAAGTTGTCTGG - Intronic
1099332528 12:81307662-81307684 AGGTCTCAGTGGAGGTTGGAAGG - Intronic
1099920967 12:88956714-88956736 AAGTCTCAGGGGAGGTGGGAGGG - Intergenic
1102875429 12:116445132-116445154 GTGTCCAAGGGGGAGTTGGCAGG + Intergenic
1104021400 12:124994428-124994450 AGGTCCCAGGGGAAGTGGGTCGG - Intronic
1106075458 13:26457047-26457069 ATGTCTCAGGGGAGATTGCAAGG - Intergenic
1107106095 13:36644379-36644401 TTCTCCCAGGGGAGGTGGGAGGG - Intergenic
1110275134 13:73634254-73634276 GTGTCCCAGAGGAAGTTGGGAGG + Intergenic
1114613049 14:24054566-24054588 CTGGCCCAGGGGAAGGAGGAAGG - Intronic
1115857763 14:37649447-37649469 CTGGCCCAGAGGAAGTTGGCAGG - Intronic
1118077131 14:62311704-62311726 ATATCTCAGGGGCAGCTGGAAGG + Intergenic
1119568831 14:75651844-75651866 ATGCCCCAGGGCAAGGAGGAAGG + Exonic
1121343504 14:93118557-93118579 ATGGACCAGGGGAACTTGGGAGG + Intergenic
1121514206 14:94538480-94538502 ATATCCCAGTGGAAGGTGGCAGG + Intergenic
1122319070 14:100842531-100842553 ATTTGTCAGGGGAAGTTGTAAGG + Intergenic
1123581081 15:21715351-21715373 ATGTCCCAGGAGGCCTTGGAAGG + Intergenic
1123617730 15:22157974-22157996 ATGTCCCAGGAGGCCTTGGAAGG + Intergenic
1124134469 15:27022046-27022068 ATCTACCAGGGGAAGGTGGCAGG - Intronic
1126652891 15:50943834-50943856 ATGTCCCAGATGGAGTAGGATGG + Intronic
1127362576 15:58257794-58257816 ATTTCCCAGAGGATGCTGGAGGG - Intronic
1127688391 15:61370896-61370918 ATGCCCCATAGGAAGATGGAAGG + Intergenic
1128223299 15:65983513-65983535 ATGTTCTGGGAGAAGTTGGATGG + Intronic
1128777176 15:70329412-70329434 ATGTCCAAGGGGAGGGAGGAGGG - Intergenic
1129125943 15:73441529-73441551 ATTTCCCGAGGGAAGATGGAAGG - Intergenic
1129336828 15:74857208-74857230 CTGTCGCAGAGGAGGTTGGAAGG - Intronic
1130799335 15:87245290-87245312 TTACCCCAGGGGGAGTTGGAGGG + Intergenic
1130857190 15:87850928-87850950 ATGTCTCAGCAGAAGTTTGAGGG + Intergenic
1131158895 15:90091671-90091693 ATGCCCCTGGGGAGGCTGGAGGG + Intronic
1131970805 15:97891206-97891228 AAGACCCATGGGAAGTTGGTAGG + Intergenic
1132380593 15:101363228-101363250 ATGTCCCAGGGCAGCTTTGAGGG - Intronic
1133553057 16:6877253-6877275 ATGTCCTAGAGAAAGATGGATGG + Intronic
1134739419 16:16529468-16529490 AAGTCCCAGGGTAAGTCTGAAGG + Intergenic
1134928080 16:18182683-18182705 AAGTCCCAGGGTAAGTCTGAAGG - Intergenic
1135961321 16:26996747-26996769 AGGTCCCTGGGGATGGTGGAAGG - Intergenic
1136251687 16:29009537-29009559 ATGTCCCAGGGCCAGGAGGAGGG - Intergenic
1136366121 16:29809982-29810004 GTGTCCCAGGGGAAGCAGGCTGG + Intronic
1137895467 16:52207037-52207059 ATGTCACACAGGAAGTTGGTAGG + Intergenic
1138535944 16:57660460-57660482 ATGTCACAGGGGAGATGGGAGGG - Intronic
1139795838 16:69482253-69482275 ATGTCCCAGTGAACGCTGGAAGG - Intergenic
1140451296 16:75072882-75072904 ATCTCAGAGGGGAAGCTGGAGGG - Intronic
1142120669 16:88385107-88385129 TTCTCCCAGGGGAAGGTGGCAGG - Intergenic
1145266202 17:21380719-21380741 ATGTCCAAGGGAAGGTTGGATGG - Intronic
1145989496 17:29070419-29070441 ATGTCCTAGGAGAAGATGGAAGG + Intergenic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1149456252 17:56791091-56791113 TTGTCCCAAGGGAGGTTGGGTGG - Intergenic
1149567471 17:57650312-57650334 AAGGCCCAGGGGATGCTGGAGGG - Intronic
1151953702 17:77370000-77370022 CTGTCCCAAGGGAAGGGGGATGG - Intronic
1153729575 18:7996222-7996244 TTATCCCAGGGGAAAATGGATGG + Intronic
1154080308 18:11249839-11249861 AACTCCCATGGGAAGGTGGAGGG - Intergenic
1157574450 18:48734166-48734188 TTGTCCCAGGGGAAGTGGGTGGG - Intronic
1161004008 19:1925484-1925506 GTGTTCCAGGGGGAGTTGGGGGG - Exonic
1163190345 19:15672857-15672879 AGTTTGCAGGGGAAGTTGGAGGG - Exonic
1165816378 19:38645006-38645028 CTTTCCCAGGAGAAGCTGGAGGG - Intergenic
1167080010 19:47271983-47272005 AAGGCCCAGGGGGAGTTGAAGGG - Intergenic
1167360965 19:49030150-49030172 GTGGCCCAGGGGTAGGTGGAGGG + Intronic
1167363450 19:49042542-49042564 GTGGCCCAGGGGTAGGTGGAGGG + Intergenic
1168259550 19:55185814-55185836 ATGTCACAGGGGAAGGCTGAGGG + Intronic
1168435741 19:56315514-56315536 AAGTCACAGGGGAACTGGGAGGG - Intronic
925366337 2:3314654-3314676 AGGTCCCAGGGGGATTGGGAGGG - Intronic
925521386 2:4749656-4749678 ATCTTCCTGGGGAAGTTGGGAGG - Intergenic
925798727 2:7575091-7575113 AGGTCCCAGGTGTGGTTGGAGGG - Intergenic
926707770 2:15848785-15848807 TTGTCCCAGACGAGGTTGGAAGG + Intergenic
928945076 2:36764875-36764897 ATGTCAAAGGGGAAGGTGGATGG + Intronic
932437288 2:71710004-71710026 AAGTCAAAGGGGAAGATGGAGGG - Intergenic
935950587 2:108325186-108325208 ATTGCCCTGGGTAAGTTGGAAGG + Intergenic
936000164 2:108819633-108819655 ATGTCTCAGAAGAATTTGGATGG + Intronic
937049257 2:118875250-118875272 ATGTCTGAGGAGCAGTTGGAGGG - Intergenic
937095499 2:119232796-119232818 AGGTCCCAGGGGTAGGTGGTGGG - Intronic
937393538 2:121514391-121514413 ATCTCTTAGGGAAAGTTGGAGGG - Intronic
937718589 2:125063903-125063925 CTCTCCCAGTGGAAGATGGAAGG + Intergenic
943721372 2:191206507-191206529 ATTTCCCCGAGGAAGCTGGAAGG - Intergenic
944358001 2:198815885-198815907 ATGACCCGGTGGAAGTTGAAAGG - Intergenic
944666703 2:201965011-201965033 TTGTCCCAGGGGCATTGGGAGGG - Intergenic
945656287 2:212628012-212628034 ATGACCTAGGGGAAGTAGGAAGG + Intergenic
946158470 2:217821999-217822021 GTGTTCCAGGGGAGGTTGGGGGG - Intronic
946732727 2:222724737-222724759 CAGTCCCAGGGAAAGTAGGATGG + Intergenic
947615629 2:231555131-231555153 AGGTCTCAGGAGAACTTGGAGGG + Intergenic
947744622 2:232501224-232501246 ATGTGCCAGGGGCAGGGGGAAGG - Intergenic
1169560079 20:6790395-6790417 AAGTCTCAAGGGAAGTGGGAAGG + Intergenic
1170217679 20:13908873-13908895 ATGTACAAAGGGAAGCTGGATGG - Intronic
1170756672 20:19212063-19212085 CTGTGCCAGGGGAAGAGGGACGG - Intergenic
1173758595 20:45539729-45539751 ATTTCCCAGGGGGAGTTTGCAGG + Intronic
1173842007 20:46163672-46163694 ATTTCCCAGGGGAAGGGGGGGGG - Intergenic
1176991198 21:15498217-15498239 ATATCCAAGTGGAAGTTTGAAGG - Intergenic
1177627389 21:23680610-23680632 ATATCCAAGGGAAAATTGGATGG - Intergenic
1178100164 21:29259318-29259340 ATGTCCCAGAGGAAATTTCAAGG - Intronic
1178887573 21:36495944-36495966 AGGCCCCACTGGAAGTTGGAAGG + Intronic
1182287258 22:29255732-29255754 CTGGCCCAGAGGAGGTTGGAGGG + Intronic
1184142657 22:42587242-42587264 ATATCTGAGTGGAAGTTGGAGGG - Intronic
949202809 3:1399975-1399997 ATATCCCAGTGGAAGTGGGGTGG + Intronic
949626594 3:5874230-5874252 ATGTCCCAGTGGCAGTGGGCTGG - Intergenic
950218313 3:11175391-11175413 ATATCCCAGGGGAAATGGGATGG + Intronic
952071068 3:29636478-29636500 ATGTGCGAGGGGAGGGTGGAAGG + Intronic
955164048 3:56493136-56493158 ATCTACCAGGGGAAAGTGGAGGG - Intergenic
956548289 3:70431746-70431768 ATTTCACAAGGGAAATTGGATGG - Intergenic
957540730 3:81565534-81565556 AAGCCACAGGGGAAGTTGGATGG - Intronic
958452456 3:94290802-94290824 ATGTCCATGTGGAAGTTAGAGGG + Intergenic
958821629 3:98980540-98980562 ATGTCCCTGAGGAACTTTGATGG - Intergenic
958880285 3:99661941-99661963 ATGTGCCAGGGGATGAGGGAAGG + Intronic
960395392 3:117131090-117131112 ATGTCGAAGAGGAAGCTGGACGG + Intronic
965638344 3:170807526-170807548 ATCTGCCAGGGGAAGTTATAAGG - Intronic
967478390 3:189946732-189946754 CGGTCCCAGGGAAAGTGGGATGG + Intergenic
967517399 3:190386549-190386571 ATATCCCATGTGAAGTGGGATGG + Intronic
968728114 4:2257574-2257596 TTGTCCGAGGGGCAGATGGAGGG - Intronic
971344307 4:25797987-25798009 AAGTCAGAGGGGAAGTGGGAGGG + Intronic
972701501 4:41498296-41498318 ATGTCCCAGGGTGATTTTGAGGG - Intronic
976230113 4:82833885-82833907 ATGTCCCAGGGAAACTGTGAGGG + Intronic
977732461 4:100370328-100370350 ATGTCCTGGGGGAAGGGGGAAGG + Intergenic
979268608 4:118732689-118732711 ATTTCCCAGAGGAGGCTGGAAGG - Intronic
980237876 4:130131927-130131949 TTGTTCCAGTGGAAGTTGCAGGG - Intergenic
982806485 4:159771955-159771977 ATGGCACAGGGAAAGATGGAAGG - Intergenic
983235899 4:165178891-165178913 ATGGCTCAGTGTAAGTTGGAAGG - Intronic
984314988 4:178117858-178117880 ATTTCCCAGGCAAGGTTGGAAGG - Intergenic
984825116 4:183917221-183917243 ATGCCCCAGGGGTTGATGGAAGG + Intronic
986165617 5:5269416-5269438 ATGACCCAGGGGCAGGTGTAAGG - Intronic
986627122 5:9732494-9732516 ATGGACAAGGGGAAGATGGAAGG + Intergenic
986681001 5:10232748-10232770 ATGGCCCAGGGGAGGCTGGAGGG + Intronic
988224932 5:28400910-28400932 ATGACACATGGGAAGTTGAATGG - Intergenic
991631265 5:68658460-68658482 ATGCCACATGGGAAGTTGGCTGG - Intergenic
991970432 5:72135761-72135783 AGGTCCCAGGGAAATCTGGATGG - Intronic
992131574 5:73698212-73698234 GTGTCCGAGGGGAAATTGAATGG + Intronic
996646878 5:125827521-125827543 ATGAGCCAGGGAAAGTGGGATGG - Intergenic
997030049 5:130117060-130117082 GTCACCCAGGTGAAGTTGGATGG + Intronic
998616782 5:143749680-143749702 ATTTCCCAGGCAAGGTTGGAAGG + Intergenic
1003719647 6:8686387-8686409 ATGTTACAGGGAAGGTTGGAGGG + Intergenic
1007719954 6:43879021-43879043 ACTTCCCAGGGGACGTTGCATGG + Intergenic
1008853285 6:56051004-56051026 TTGTCCCAGTTGAAGTTGAAAGG + Intergenic
1009413312 6:63391629-63391651 ATCTCCCTTGGGAATTTGGAGGG - Intergenic
1009508168 6:64512477-64512499 ATGGCCCAGGGGAAGGGGGAGGG + Intronic
1009715448 6:67387293-67387315 ATGACCCAGAAGAAGTTGGTGGG - Intergenic
1010179189 6:73065461-73065483 ATGTCAGAGAGGAAGCTGGAAGG - Intronic
1010290482 6:74130927-74130949 AAGTTCCAGGGGAAGTGGAAAGG + Intergenic
1012583673 6:100897930-100897952 GTGTCTCAGGGGGAGTTGCATGG - Intergenic
1017748082 6:157465050-157465072 ATGTCACAGGGTAGGTTAGATGG - Intronic
1018383884 6:163285318-163285340 ATGTGTCAGGGGAAGCGGGAGGG - Intronic
1019051113 6:169184793-169184815 ATGTCCCTGAAGGAGTTGGAGGG - Intergenic
1019760916 7:2811999-2812021 CTTTCCCAGGGGCAGTGGGAAGG + Intronic
1019898780 7:4003358-4003380 GTGTCACAGGGGAAGCTGGGTGG - Intronic
1020073282 7:5241348-5241370 ATGTCCCCGGGGAAGGAGGGTGG + Intergenic
1021862577 7:24921683-24921705 ATGTCTCAGTGGGAGTAGGATGG - Intronic
1023990832 7:45127308-45127330 GGGTCCCAGGGGAAGTTTTAAGG - Intergenic
1026671445 7:72394177-72394199 ATGTCCCTGAGGAAGTGAGAGGG - Intronic
1026831231 7:73611411-73611433 TTGTCCCAGAGGAAGTTGGCTGG - Intronic
1027187104 7:75979300-75979322 AAGTCCCAGAGGAACTTAGAAGG + Intronic
1029272445 7:99385285-99385307 ATGGGGCAGGGGAAGTTGGGTGG + Intronic
1033157725 7:138971163-138971185 AGGGCCCAGTTGAAGTTGGAAGG - Intronic
1033790306 7:144785117-144785139 CTGTCCCAGGGGAATGGGGAAGG + Intronic
1033895402 7:146063581-146063603 AGGCCCCAGTGGAAGATGGAAGG + Intergenic
1034165422 7:149021704-149021726 ATGTCCCAGGGGAAGTTGGAGGG + Intronic
1035055264 7:156031074-156031096 CTGGCCCAGTGGAAGCTGGAAGG - Intergenic
1035074630 7:156169554-156169576 TTGTCCCGGGGGTAGGTGGAGGG + Intergenic
1036678532 8:10853783-10853805 AAGTCCCAGGGGCAGATGGGTGG + Intergenic
1038776092 8:30532002-30532024 ATTTCCCTGGTGAAGCTGGAGGG + Intronic
1039209456 8:35196124-35196146 TTGTCCCAGGGGAAGCTGACTGG + Intergenic
1042208571 8:66353863-66353885 ATGCCCCAGGGGTAGTTAGCTGG - Intergenic
1042435052 8:68754530-68754552 AAGGCCCAGGGAAATTTGGATGG - Intronic
1044774006 8:95668918-95668940 ATGTCCCAGGAGATGTTGGAAGG - Intergenic
1045809185 8:106201564-106201586 ATGTGCCTGGAGGAGTTGGAAGG - Intergenic
1048217700 8:132511645-132511667 ATTTCCCTGGGGAGGTTGTATGG + Intergenic
1048880252 8:138866728-138866750 ATGTCCCAGTGGAACTAGAAGGG - Intronic
1049160788 8:141096248-141096270 AAGTCCCAGGGGCAGGAGGAGGG + Intergenic
1050697839 9:8298837-8298859 ATGTACCAGTAGAAGTTGGTTGG - Intergenic
1052575175 9:30282173-30282195 TCCTCCCAGAGGAAGTTGGAGGG - Intergenic
1053478073 9:38396298-38396320 ATGACCAAGGGGAAGTTCCACGG - Exonic
1054925397 9:70583902-70583924 ATAGCCCAGGGGAAGGTGGGTGG - Intronic
1055400178 9:75915087-75915109 CTTTCCTAGGGGAAGTTAGAAGG + Intronic
1056238778 9:84622734-84622756 ATTTCCCAGGGTAAGTGGTAGGG + Intergenic
1056773279 9:89495184-89495206 ATGCCCCAGGGGAAGCAGCAAGG + Intronic
1057304341 9:93903657-93903679 TTGTCCCTGGGCAGGTTGGAAGG - Intergenic
1059544858 9:115166309-115166331 ATGTTCCAGGCGAGGTAGGAGGG - Intronic
1060303047 9:122387176-122387198 ATGTCCAAGCAGAAATTGGAAGG + Intronic
1060684939 9:125601222-125601244 TTGTCCTCGGGGTAGTTGGAGGG - Intronic
1061430251 9:130526335-130526357 CTGGCCGAGGGGAAGTGGGATGG + Intergenic
1062151530 9:135021666-135021688 GTGTCCCAGGCGAAGCTTGAGGG - Intergenic
1062645184 9:137544189-137544211 AGGTCAGAGGGGAAGTTGGGGGG - Intronic
1203770093 EBV:45494-45516 ATGTCCCAGGGGACGTCGGCAGG - Intergenic
1187895832 X:23978690-23978712 TTGTGCCAGGGGAAATTGCATGG - Intergenic
1192576251 X:72245594-72245616 ATCTCCCAGGGGAAGCAGGAAGG + Intronic
1193499280 X:82254100-82254122 ATGTCCTACTTGAAGTTGGAGGG - Intergenic
1193826729 X:86235427-86235449 ATGACCTAGGTGAAGATGGAAGG - Intronic
1198255291 X:134919116-134919138 ATGTCCTAGGGAAGGGTGGATGG - Intergenic
1198868753 X:141153971-141153993 ATGTCTCAGTAGAAGTTCGAAGG + Intergenic
1199852187 X:151732661-151732683 ATGTCCAGTTGGAAGTTGGAAGG + Intergenic
1200139007 X:153888332-153888354 AAGTCCCAGGAGAAGCAGGAGGG + Intronic