ID: 1034168828

View in Genome Browser
Species Human (GRCh38)
Location 7:149046968-149046990
Sequence GCCTGAAGTTATGCTATGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034168828_1034168830 -7 Left 1034168828 7:149046968-149046990 CCTGGCATAGCATAACTTCAGGC No data
Right 1034168830 7:149046984-149047006 TTCAGGCGTAGCTTAATCCAGGG No data
1034168828_1034168835 18 Left 1034168828 7:149046968-149046990 CCTGGCATAGCATAACTTCAGGC No data
Right 1034168835 7:149047009-149047031 CCAATAATGTTAACAGGAGGAGG No data
1034168828_1034168833 15 Left 1034168828 7:149046968-149046990 CCTGGCATAGCATAACTTCAGGC No data
Right 1034168833 7:149047006-149047028 GCTCCAATAATGTTAACAGGAGG No data
1034168828_1034168829 -8 Left 1034168828 7:149046968-149046990 CCTGGCATAGCATAACTTCAGGC No data
Right 1034168829 7:149046983-149047005 CTTCAGGCGTAGCTTAATCCAGG No data
1034168828_1034168832 12 Left 1034168828 7:149046968-149046990 CCTGGCATAGCATAACTTCAGGC No data
Right 1034168832 7:149047003-149047025 AGGGCTCCAATAATGTTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034168828 Original CRISPR GCCTGAAGTTATGCTATGCC AGG (reversed) Intergenic