ID: 1034168832

View in Genome Browser
Species Human (GRCh38)
Location 7:149047003-149047025
Sequence AGGGCTCCAATAATGTTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034168828_1034168832 12 Left 1034168828 7:149046968-149046990 CCTGGCATAGCATAACTTCAGGC No data
Right 1034168832 7:149047003-149047025 AGGGCTCCAATAATGTTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034168832 Original CRISPR AGGGCTCCAATAATGTTAAC AGG Intergenic