ID: 1034174535

View in Genome Browser
Species Human (GRCh38)
Location 7:149090542-149090564
Sequence CCGGGCTCGCCCGTGTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 92}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034174535_1034174552 22 Left 1034174535 7:149090542-149090564 CCCCAGGACACGGGCGAGCCCGG 0: 1
1: 0
2: 1
3: 8
4: 92
Right 1034174552 7:149090587-149090609 CCGAAACCGGGCGTCCAAACAGG 0: 1
1: 0
2: 0
3: 0
4: 11
1034174535_1034174546 10 Left 1034174535 7:149090542-149090564 CCCCAGGACACGGGCGAGCCCGG 0: 1
1: 0
2: 1
3: 8
4: 92
Right 1034174546 7:149090575-149090597 CCCACCACGACCCCGAAACCGGG 0: 1
1: 0
2: 0
3: 10
4: 123
1034174535_1034174544 9 Left 1034174535 7:149090542-149090564 CCCCAGGACACGGGCGAGCCCGG 0: 1
1: 0
2: 1
3: 8
4: 92
Right 1034174544 7:149090574-149090596 ACCCACCACGACCCCGAAACCGG 0: 1
1: 0
2: 0
3: 3
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034174535 Original CRISPR CCGGGCTCGCCCGTGTCCTG GGG (reversed) Intronic
900977328 1:6025836-6025858 CCGGGATCGGCTGTGTGCTGGGG - Intronic
901050310 1:6422933-6422955 CCGGGCTCTCCCATGTCCACCGG - Intronic
901668133 1:10838100-10838122 CCGGGCTAGGCTGGGTCCTGGGG - Intergenic
901703853 1:11059534-11059556 TCGGGCTCTGACGTGTCCTGAGG + Intronic
904160369 1:28518410-28518432 CCGCTCTCGCCCGTGTCGCGCGG + Intronic
905653555 1:39671992-39672014 CCGGGCTCGCGGGGCTCCTGGGG + Exonic
906511206 1:46411341-46411363 ATGGCCTCTCCCGTGTCCTGAGG + Intronic
906678722 1:47710704-47710726 CTGGGCTGACCCGTGTCCCGCGG + Intergenic
923008167 1:230067972-230067994 CCTGGCTCGCACGGGCCCTGGGG - Intronic
1070152126 10:73811504-73811526 CCGGGCTCCGCCGCGTCCCGGGG + Exonic
1071997620 10:91163178-91163200 CCGGGCTCGCCTGGCTCCCGGGG - Intronic
1074045572 10:109835563-109835585 CCTGGCCAGCCCTTGTCCTGAGG - Intergenic
1076151193 10:128163205-128163227 CAGGGATCGCTCTTGTCCTGTGG - Intergenic
1077233721 11:1469993-1470015 ACGGCCCCGGCCGTGTCCTGTGG - Exonic
1077484376 11:2832127-2832149 CCGGGCTGGTGTGTGTCCTGGGG - Intronic
1083802202 11:65053234-65053256 TGGAGCTCTCCCGTGTCCTGGGG - Exonic
1084022567 11:66426370-66426392 CCGGGCCAGCCCGTGCCCTGAGG + Exonic
1084473210 11:69375035-69375057 CAGGGCTCGCCCTGGGCCTGAGG + Intergenic
1084537367 11:69764904-69764926 CCGTGCTGGTCCATGTCCTGTGG - Intergenic
1084707573 11:70824190-70824212 CAGGGCTGCCCTGTGTCCTGGGG - Intronic
1091563705 12:1632732-1632754 CCGGGCTCTCCCCTGGCCAGAGG + Exonic
1103749906 12:123151292-123151314 CCCGGCTCGCCCGTGTCCTCAGG + Intergenic
1104560562 12:129840262-129840284 CCGGGCTCCCCAGTGACCTTGGG + Intronic
1105768071 13:23579891-23579913 CGGCGCCCGCCCGCGTCCTGCGG + Intronic
1108221098 13:48233608-48233630 CCCGGCGCTCCCGTTTCCTGTGG + Intronic
1123118343 14:105904881-105904903 CCGTGCCCACCTGTGTCCTGAGG + Intergenic
1127916504 15:63459428-63459450 CCAGTCCCGCCCGTGTGCTGCGG - Intergenic
1129163455 15:73761018-73761040 CAGGGCTCAAACGTGTCCTGTGG - Intergenic
1129269868 15:74413923-74413945 ACTGGCTCCTCCGTGTCCTGTGG + Intronic
1136117576 16:28104600-28104622 CCGTGCTGGCCAGTGTCCAGAGG - Exonic
1136598066 16:31265558-31265580 CCAGGCACTCCTGTGTCCTGGGG + Intronic
1138179631 16:54932867-54932889 TCGGGGTCGCCCTTGTCCTCGGG - Exonic
1142966480 17:3585102-3585124 CAGGGCTCACCCCTGGCCTGGGG - Intronic
1143036783 17:4004084-4004106 CCGGGTTCCGCAGTGTCCTGCGG + Intergenic
1146887503 17:36482553-36482575 CCTGGCTCATCCGTGCCCTGGGG + Intergenic
1152515017 17:80817980-80818002 CCGGGCTCACCTGTGGCATGCGG - Intronic
1153250016 18:3112104-3112126 CCTGGCTCAACCCTGTCCTGAGG + Intronic
1154325402 18:13387429-13387451 CCAGGGGCGCCCGTGTTCTGAGG + Exonic
1156456854 18:37299583-37299605 GCGGGCTCGGCTGTCTCCTGCGG + Intronic
1158427501 18:57352866-57352888 CCCGGGTCGCCAGTGTGCTGGGG + Exonic
1160982155 19:1821417-1821439 CCAGCCTCGCCCCTGCCCTGCGG - Intronic
1161043284 19:2121401-2121423 CCGGGTCCGCCTGTGTCCCGTGG - Intronic
1161170188 19:2808595-2808617 CCTGTCATGCCCGTGTCCTGGGG + Intronic
1161516969 19:4702015-4702037 CCGGGCACTCACCTGTCCTGGGG + Exonic
1161907458 19:7167713-7167735 CCGGACTGGCCAGTTTCCTGGGG - Intronic
1163114089 19:15178855-15178877 CCGTCCTAGCCCGGGTCCTGGGG - Exonic
1165686890 19:37829633-37829655 CCGTGCTCGCCCTTGGCCTGAGG - Intergenic
1165798743 19:38534877-38534899 CCTGGCTCGCCCATTCCCTGTGG + Intronic
1166131503 19:40748603-40748625 CAGGGCTCCCCCGTGCCCTCAGG + Intronic
1167103912 19:47419518-47419540 CCGGTCTCTCCCTTGTCTTGTGG + Intronic
925226325 2:2186345-2186367 CCGGGCCTTCCCGAGTCCTGCGG + Intronic
930461427 2:51682830-51682852 CAGGACTCCCCAGTGTCCTGAGG - Intergenic
931516224 2:63051955-63051977 CTGTTCTCGACCGTGTCCTGGGG + Intronic
932708746 2:74047120-74047142 CCGGGCTCCCTCATGGCCTGTGG + Exonic
947476800 2:230457410-230457432 CAGGGCTGGCCTGAGTCCTGGGG + Intronic
948578370 2:238968434-238968456 TCGGGCTCCTCCGTGTCCAGTGG + Intergenic
1175846182 20:62060120-62060142 CCGGGCTCCCCGGTGTGCTGTGG - Intronic
1176026373 20:62987632-62987654 CCGTGTTCACCCGTGTCCTCAGG - Intergenic
1176033350 20:63024435-63024457 CCGGGCTGGCCAGTGTCCAGCGG - Intergenic
1180064392 21:45405309-45405331 CGGGGCTCGGCCGGGTCCTGCGG + Intronic
1183191391 22:36323936-36323958 CCAGGCCCGCCCGAGGCCTGTGG - Intronic
955281376 3:57597572-57597594 CCGGCCTCTCCCGGCTCCTGGGG - Intronic
965026241 3:163304544-163304566 CAGGGCCCACCCATGTCCTGCGG + Intergenic
966182347 3:177197982-177198004 GCGGGCTCCCGCGTGTCCGGGGG + Intergenic
968589079 4:1448831-1448853 CTGGCCTCGCCTGTGTGCTGAGG + Intergenic
968656013 4:1778744-1778766 CCTGGCCCGCCCCTGTTCTGTGG + Intergenic
979690424 4:123553430-123553452 CCAGGCTCGCCCATTTCCTAGGG + Intergenic
986123745 5:4866898-4866920 AAGGGCTCACCCTTGTCCTGGGG + Intergenic
988100439 5:26669675-26669697 CCGCCCTCGCCTGCGTCCTGCGG + Intergenic
988499883 5:31775877-31775899 CCTGGCTCTCCCGGGCCCTGTGG + Intronic
993901230 5:93585177-93585199 CCGGGCTGGCCCGGGGTCTGCGG - Exonic
994197501 5:96936202-96936224 CCGGGCTCTCCGGAGCCCTGAGG + Intronic
999768114 5:154755854-154755876 CCGGGCTCGCCCTTGCCCTCGGG - Intronic
1002516016 5:179759625-179759647 CAGGGCTCCCGAGTGTCCTGTGG + Intronic
1004424224 6:15496831-15496853 TCGGCCTTGCCCGAGTCCTGCGG - Exonic
1004615057 6:17281456-17281478 CCGGGCTCGCCCTTGGCCCCCGG + Exonic
1006445016 6:34075166-34075188 CCGGCCTTGACCGTGGCCTGAGG - Intronic
1006844027 6:37050409-37050431 CCGGCCTGGCCCCTGACCTGTGG - Intergenic
1007389285 6:41541047-41541069 CCAGCCTCGCCCCAGTCCTGGGG + Intergenic
1018966720 6:168495694-168495716 CGGGTCACGCCTGTGTCCTGTGG - Intronic
1019600628 7:1881962-1881984 ACAGGCTTGCCCGTGTCCTTGGG + Intronic
1020418311 7:7969786-7969808 CCCGGCTCGCCCGTGTGCAGAGG + Exonic
1020445173 7:8261431-8261453 CCTGGCGCGCCCGTTTCCTTTGG - Intronic
1024359553 7:48454539-48454561 CCGGGCTCTCCTATGCCCTGCGG + Intronic
1029134896 7:98362976-98362998 CCAGGCAGGCCTGTGTCCTGGGG - Intronic
1032803236 7:135333262-135333284 CCTGGCTCCCCCATGCCCTGAGG + Intergenic
1034174535 7:149090542-149090564 CCGGGCTCGCCCGTGTCCTGGGG - Intronic
1034451199 7:151138204-151138226 CTGGGCTGGCCCGCGCCCTGAGG + Exonic
1034831757 7:154314600-154314622 CTGGGCTCCCCCATGCCCTGGGG - Intronic
1034914665 7:155026923-155026945 CCGGGCTCCCCAGTTTCCTCTGG - Intergenic
1034979435 7:155466828-155466850 CCGGGCGCACCTGTGTCCAGCGG - Intergenic
1045510899 8:102811005-102811027 ACGGCCCCGCCCGAGTCCTGCGG + Intergenic
1048842486 8:138577981-138578003 TCTGGCTCCCACGTGTCCTGAGG - Intergenic
1049403387 8:142440833-142440855 CCAGGCTGGGCTGTGTCCTGGGG + Intergenic
1049607965 8:143538488-143538510 CCGGGCCTGCCTGGGTCCTGAGG + Exonic
1049645495 8:143733953-143733975 CCCGACCCGCCCGTGCCCTGCGG + Intergenic
1058281372 9:103119595-103119617 CTGGTCTCGCCCTTGACCTGTGG + Intergenic
1060592784 9:124829473-124829495 CCAGGCTCGCCTGGATCCTGGGG - Intergenic
1061254444 9:129446033-129446055 CCTGGCTCGCCTGTGTCCTCAGG + Intergenic
1062192091 9:135253341-135253363 CCTGGCTCTCCCTTGTGCTGTGG - Intergenic
1187226083 X:17376146-17376168 CCGCTCTGGCCCGTGTCCTCCGG + Exonic
1199542866 X:148976983-148977005 CTGGGCTCCCCAGTGTTCTGCGG + Intronic